ID: 1194438961

View in Genome Browser
Species Human (GRCh38)
Location X:93905890-93905912
Sequence CTGAAGGAGGTTCCTGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194438961_1194438964 15 Left 1194438961 X:93905890-93905912 CCTTTTTCAGGAACCTCCTTCAG No data
Right 1194438964 X:93905928-93905950 CATTCTGATAATTTTTTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194438961 Original CRISPR CTGAAGGAGGTTCCTGAAAA AGG (reversed) Intergenic
No off target data available for this crispr