ID: 1194440097

View in Genome Browser
Species Human (GRCh38)
Location X:93921530-93921552
Sequence ATAGAGAAGCAGTGTGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194440097_1194440098 -5 Left 1194440097 X:93921530-93921552 CCTTCTTCACACTGCTTCTCTAT No data
Right 1194440098 X:93921548-93921570 TCTATGTCACTATAAAAATGTGG No data
1194440097_1194440099 7 Left 1194440097 X:93921530-93921552 CCTTCTTCACACTGCTTCTCTAT No data
Right 1194440099 X:93921560-93921582 TAAAAATGTGGCCTGTGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194440097 Original CRISPR ATAGAGAAGCAGTGTGAAGA AGG (reversed) Intergenic
No off target data available for this crispr