ID: 1194447984

View in Genome Browser
Species Human (GRCh38)
Location X:94010123-94010145
Sequence TTAGGTTATCACTTAATGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194447984_1194447988 3 Left 1194447984 X:94010123-94010145 CCAGTCATTAAGTGATAACCTAA No data
Right 1194447988 X:94010149-94010171 TGGAGATTGCCTGAATCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194447984 Original CRISPR TTAGGTTATCACTTAATGAC TGG (reversed) Intergenic
No off target data available for this crispr