ID: 1194448813

View in Genome Browser
Species Human (GRCh38)
Location X:94017168-94017190
Sequence AACTCCAGAGGAAGGTCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194448813_1194448816 3 Left 1194448813 X:94017168-94017190 CCTGAAGACCTTCCTCTGGAGTT No data
Right 1194448816 X:94017194-94017216 GTAAATGTACTTAATCCAGATGG No data
1194448813_1194448821 18 Left 1194448813 X:94017168-94017190 CCTGAAGACCTTCCTCTGGAGTT No data
Right 1194448821 X:94017209-94017231 CCAGATGGGTCCACGTGCTGGGG No data
1194448813_1194448819 17 Left 1194448813 X:94017168-94017190 CCTGAAGACCTTCCTCTGGAGTT No data
Right 1194448819 X:94017208-94017230 TCCAGATGGGTCCACGTGCTGGG No data
1194448813_1194448817 4 Left 1194448813 X:94017168-94017190 CCTGAAGACCTTCCTCTGGAGTT No data
Right 1194448817 X:94017195-94017217 TAAATGTACTTAATCCAGATGGG No data
1194448813_1194448818 16 Left 1194448813 X:94017168-94017190 CCTGAAGACCTTCCTCTGGAGTT No data
Right 1194448818 X:94017207-94017229 ATCCAGATGGGTCCACGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194448813 Original CRISPR AACTCCAGAGGAAGGTCTTC AGG (reversed) Intergenic
No off target data available for this crispr