ID: 1194448818

View in Genome Browser
Species Human (GRCh38)
Location X:94017207-94017229
Sequence ATCCAGATGGGTCCACGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194448815_1194448818 4 Left 1194448815 X:94017180-94017202 CCTCTGGAGTTTCAGTAAATGTA No data
Right 1194448818 X:94017207-94017229 ATCCAGATGGGTCCACGTGCTGG No data
1194448813_1194448818 16 Left 1194448813 X:94017168-94017190 CCTGAAGACCTTCCTCTGGAGTT No data
Right 1194448818 X:94017207-94017229 ATCCAGATGGGTCCACGTGCTGG No data
1194448814_1194448818 8 Left 1194448814 X:94017176-94017198 CCTTCCTCTGGAGTTTCAGTAAA No data
Right 1194448818 X:94017207-94017229 ATCCAGATGGGTCCACGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194448818 Original CRISPR ATCCAGATGGGTCCACGTGC TGG Intergenic
No off target data available for this crispr