ID: 1194456963

View in Genome Browser
Species Human (GRCh38)
Location X:94116618-94116640
Sequence TGGGTCCCCTTGGCAAAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194456954_1194456963 21 Left 1194456954 X:94116574-94116596 CCTCCTTTCCTATCATGACCTGA No data
Right 1194456963 X:94116618-94116640 TGGGTCCCCTTGGCAAAAAGGGG No data
1194456955_1194456963 18 Left 1194456955 X:94116577-94116599 CCTTTCCTATCATGACCTGAACT No data
Right 1194456963 X:94116618-94116640 TGGGTCCCCTTGGCAAAAAGGGG No data
1194456957_1194456963 3 Left 1194456957 X:94116592-94116614 CCTGAACTCATATTTCAGTATTT No data
Right 1194456963 X:94116618-94116640 TGGGTCCCCTTGGCAAAAAGGGG No data
1194456953_1194456963 22 Left 1194456953 X:94116573-94116595 CCCTCCTTTCCTATCATGACCTG No data
Right 1194456963 X:94116618-94116640 TGGGTCCCCTTGGCAAAAAGGGG No data
1194456956_1194456963 13 Left 1194456956 X:94116582-94116604 CCTATCATGACCTGAACTCATAT No data
Right 1194456963 X:94116618-94116640 TGGGTCCCCTTGGCAAAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194456963 Original CRISPR TGGGTCCCCTTGGCAAAAAG GGG Intergenic
No off target data available for this crispr