ID: 1194457277

View in Genome Browser
Species Human (GRCh38)
Location X:94120644-94120666
Sequence GAAAATAAAGGGATGGTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194457277_1194457281 -2 Left 1194457277 X:94120644-94120666 CCTTTTACCATCCCTTTATTTTC No data
Right 1194457281 X:94120665-94120687 TCAGTCATGTGTGTCTTTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194457277 Original CRISPR GAAAATAAAGGGATGGTAAA AGG (reversed) Intergenic
No off target data available for this crispr