ID: 1194467903

View in Genome Browser
Species Human (GRCh38)
Location X:94255820-94255842
Sequence TTCTCTCTTTATTGTGGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194467903_1194467910 30 Left 1194467903 X:94255820-94255842 CCACAGCCACAATAAAGAGAGAA No data
Right 1194467910 X:94255873-94255895 TCCCCATTTTCCACCAAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194467903 Original CRISPR TTCTCTCTTTATTGTGGCTG TGG (reversed) Intergenic
No off target data available for this crispr