ID: 1194467907

View in Genome Browser
Species Human (GRCh38)
Location X:94255858-94255880
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194467907_1194467915 4 Left 1194467907 X:94255858-94255880 CCTGTTGAGTTCCCATCCCCATT No data
Right 1194467915 X:94255885-94255907 ACCAAGCATGGCCCCAGACATGG No data
1194467907_1194467917 12 Left 1194467907 X:94255858-94255880 CCTGTTGAGTTCCCATCCCCATT No data
Right 1194467917 X:94255893-94255915 TGGCCCCAGACATGGCCCCATGG No data
1194467907_1194467910 -8 Left 1194467907 X:94255858-94255880 CCTGTTGAGTTCCCATCCCCATT No data
Right 1194467910 X:94255873-94255895 TCCCCATTTTCCACCAAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194467907 Original CRISPR AATGGGGATGGGAACTCAAC AGG (reversed) Intergenic
No off target data available for this crispr