ID: 1194467910

View in Genome Browser
Species Human (GRCh38)
Location X:94255873-94255895
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194467905_1194467910 6 Left 1194467905 X:94255844-94255866 CCTAGTCTCTCTTCCCTGTTGAG No data
Right 1194467910 X:94255873-94255895 TCCCCATTTTCCACCAAGCATGG No data
1194467907_1194467910 -8 Left 1194467907 X:94255858-94255880 CCTGTTGAGTTCCCATCCCCATT No data
Right 1194467910 X:94255873-94255895 TCCCCATTTTCCACCAAGCATGG No data
1194467904_1194467910 24 Left 1194467904 X:94255826-94255848 CCACAATAAAGAGAGAAGCCTAG No data
Right 1194467910 X:94255873-94255895 TCCCCATTTTCCACCAAGCATGG No data
1194467906_1194467910 -7 Left 1194467906 X:94255857-94255879 CCCTGTTGAGTTCCCATCCCCAT No data
Right 1194467910 X:94255873-94255895 TCCCCATTTTCCACCAAGCATGG No data
1194467903_1194467910 30 Left 1194467903 X:94255820-94255842 CCACAGCCACAATAAAGAGAGAA No data
Right 1194467910 X:94255873-94255895 TCCCCATTTTCCACCAAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194467910 Original CRISPR TCCCCATTTTCCACCAAGCA TGG Intergenic