ID: 1194467915

View in Genome Browser
Species Human (GRCh38)
Location X:94255885-94255907
Sequence ACCAAGCATGGCCCCAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194467909_1194467915 -8 Left 1194467909 X:94255870-94255892 CCATCCCCATTTTCCACCAAGCA No data
Right 1194467915 X:94255885-94255907 ACCAAGCATGGCCCCAGACATGG No data
1194467907_1194467915 4 Left 1194467907 X:94255858-94255880 CCTGTTGAGTTCCCATCCCCATT No data
Right 1194467915 X:94255885-94255907 ACCAAGCATGGCCCCAGACATGG No data
1194467905_1194467915 18 Left 1194467905 X:94255844-94255866 CCTAGTCTCTCTTCCCTGTTGAG No data
Right 1194467915 X:94255885-94255907 ACCAAGCATGGCCCCAGACATGG No data
1194467906_1194467915 5 Left 1194467906 X:94255857-94255879 CCCTGTTGAGTTCCCATCCCCAT No data
Right 1194467915 X:94255885-94255907 ACCAAGCATGGCCCCAGACATGG No data
1194467908_1194467915 -7 Left 1194467908 X:94255869-94255891 CCCATCCCCATTTTCCACCAAGC No data
Right 1194467915 X:94255885-94255907 ACCAAGCATGGCCCCAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194467915 Original CRISPR ACCAAGCATGGCCCCAGACA TGG Intergenic
No off target data available for this crispr