ID: 1194467917

View in Genome Browser
Species Human (GRCh38)
Location X:94255893-94255915
Sequence TGGCCCCAGACATGGCCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194467906_1194467917 13 Left 1194467906 X:94255857-94255879 CCCTGTTGAGTTCCCATCCCCAT No data
Right 1194467917 X:94255893-94255915 TGGCCCCAGACATGGCCCCATGG No data
1194467911_1194467917 -4 Left 1194467911 X:94255874-94255896 CCCCATTTTCCACCAAGCATGGC No data
Right 1194467917 X:94255893-94255915 TGGCCCCAGACATGGCCCCATGG No data
1194467908_1194467917 1 Left 1194467908 X:94255869-94255891 CCCATCCCCATTTTCCACCAAGC No data
Right 1194467917 X:94255893-94255915 TGGCCCCAGACATGGCCCCATGG No data
1194467905_1194467917 26 Left 1194467905 X:94255844-94255866 CCTAGTCTCTCTTCCCTGTTGAG No data
Right 1194467917 X:94255893-94255915 TGGCCCCAGACATGGCCCCATGG No data
1194467909_1194467917 0 Left 1194467909 X:94255870-94255892 CCATCCCCATTTTCCACCAAGCA No data
Right 1194467917 X:94255893-94255915 TGGCCCCAGACATGGCCCCATGG No data
1194467913_1194467917 -6 Left 1194467913 X:94255876-94255898 CCATTTTCCACCAAGCATGGCCC No data
Right 1194467917 X:94255893-94255915 TGGCCCCAGACATGGCCCCATGG No data
1194467907_1194467917 12 Left 1194467907 X:94255858-94255880 CCTGTTGAGTTCCCATCCCCATT No data
Right 1194467917 X:94255893-94255915 TGGCCCCAGACATGGCCCCATGG No data
1194467912_1194467917 -5 Left 1194467912 X:94255875-94255897 CCCATTTTCCACCAAGCATGGCC No data
Right 1194467917 X:94255893-94255915 TGGCCCCAGACATGGCCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194467917 Original CRISPR TGGCCCCAGACATGGCCCCA TGG Intergenic
No off target data available for this crispr