ID: 1194482681

View in Genome Browser
Species Human (GRCh38)
Location X:94446262-94446284
Sequence GAGTAGTATGAGAGGCCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194482681_1194482686 13 Left 1194482681 X:94446262-94446284 CCAGTGGGCCTCTCATACTACTC No data
Right 1194482686 X:94446298-94446320 AATCTGGCCTTTCTGCCAAGTGG No data
1194482681_1194482685 -3 Left 1194482681 X:94446262-94446284 CCAGTGGGCCTCTCATACTACTC No data
Right 1194482685 X:94446282-94446304 CTCATTTGGGTGTGTTAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194482681 Original CRISPR GAGTAGTATGAGAGGCCCAC TGG (reversed) Intergenic
No off target data available for this crispr