ID: 1194486504

View in Genome Browser
Species Human (GRCh38)
Location X:94492881-94492903
Sequence CCAGCTTTGCAGGCGGCCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194486495_1194486504 5 Left 1194486495 X:94492853-94492875 CCGCCCCGGGGTCCACCTGCTCA No data
Right 1194486504 X:94492881-94492903 CCAGCTTTGCAGGCGGCCCACGG No data
1194486496_1194486504 2 Left 1194486496 X:94492856-94492878 CCCCGGGGTCCACCTGCTCAGCT No data
Right 1194486504 X:94492881-94492903 CCAGCTTTGCAGGCGGCCCACGG No data
1194486498_1194486504 0 Left 1194486498 X:94492858-94492880 CCGGGGTCCACCTGCTCAGCTCT No data
Right 1194486504 X:94492881-94492903 CCAGCTTTGCAGGCGGCCCACGG No data
1194486497_1194486504 1 Left 1194486497 X:94492857-94492879 CCCGGGGTCCACCTGCTCAGCTC No data
Right 1194486504 X:94492881-94492903 CCAGCTTTGCAGGCGGCCCACGG No data
1194486499_1194486504 -7 Left 1194486499 X:94492865-94492887 CCACCTGCTCAGCTCTCCAGCTT No data
Right 1194486504 X:94492881-94492903 CCAGCTTTGCAGGCGGCCCACGG No data
1194486500_1194486504 -10 Left 1194486500 X:94492868-94492890 CCTGCTCAGCTCTCCAGCTTTGC No data
Right 1194486504 X:94492881-94492903 CCAGCTTTGCAGGCGGCCCACGG No data
1194486494_1194486504 8 Left 1194486494 X:94492850-94492872 CCACCGCCCCGGGGTCCACCTGC No data
Right 1194486504 X:94492881-94492903 CCAGCTTTGCAGGCGGCCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194486504 Original CRISPR CCAGCTTTGCAGGCGGCCCA CGG Intergenic
No off target data available for this crispr