ID: 1194491390

View in Genome Browser
Species Human (GRCh38)
Location X:94554348-94554370
Sequence CTGAATAATACAGATTTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194491386_1194491390 -10 Left 1194491386 X:94554335-94554357 CCTTTAGAGAACCCTGAATAATA No data
Right 1194491390 X:94554348-94554370 CTGAATAATACAGATTTTGGTGG No data
1194491385_1194491390 -9 Left 1194491385 X:94554334-94554356 CCCTTTAGAGAACCCTGAATAAT No data
Right 1194491390 X:94554348-94554370 CTGAATAATACAGATTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194491390 Original CRISPR CTGAATAATACAGATTTTGG TGG Intergenic
No off target data available for this crispr