ID: 1194491470

View in Genome Browser
Species Human (GRCh38)
Location X:94555280-94555302
Sequence TCAGTGTACTCAGCTTCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194491470_1194491473 19 Left 1194491470 X:94555280-94555302 CCTGATGAAGCTGAGTACACTGA No data
Right 1194491473 X:94555322-94555344 CCTTTTTTGCCAGAAGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194491470 Original CRISPR TCAGTGTACTCAGCTTCATC AGG (reversed) Intergenic