ID: 1194503938

View in Genome Browser
Species Human (GRCh38)
Location X:94709554-94709576
Sequence CAATGAAGGCAGAGGGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194503934_1194503938 0 Left 1194503934 X:94709531-94709553 CCACATGGCTGGGAAAGGTCTCA No data
Right 1194503938 X:94709554-94709576 CAATGAAGGCAGAGGGTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194503938 Original CRISPR CAATGAAGGCAGAGGGTGAA AGG Intergenic
No off target data available for this crispr