ID: 1194515516

View in Genome Browser
Species Human (GRCh38)
Location X:94847092-94847114
Sequence ATGTTCCTCTAGAAGATTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194515516_1194515517 8 Left 1194515516 X:94847092-94847114 CCATTAATCTTCTAGAGGAACAT No data
Right 1194515517 X:94847123-94847145 ACATTTTTGATTCTACAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194515516 Original CRISPR ATGTTCCTCTAGAAGATTAA TGG (reversed) Intergenic
No off target data available for this crispr