ID: 1194515517

View in Genome Browser
Species Human (GRCh38)
Location X:94847123-94847145
Sequence ACATTTTTGATTCTACAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194515516_1194515517 8 Left 1194515516 X:94847092-94847114 CCATTAATCTTCTAGAGGAACAT No data
Right 1194515517 X:94847123-94847145 ACATTTTTGATTCTACAAGTAGG No data
1194515514_1194515517 16 Left 1194515514 X:94847084-94847106 CCTATTCACCATTAATCTTCTAG No data
Right 1194515517 X:94847123-94847145 ACATTTTTGATTCTACAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194515517 Original CRISPR ACATTTTTGATTCTACAAGT AGG Intergenic
No off target data available for this crispr