ID: 1194520383

View in Genome Browser
Species Human (GRCh38)
Location X:94910879-94910901
Sequence GCCTAGGAATGCAGCCAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194520381_1194520383 -7 Left 1194520381 X:94910863-94910885 CCACAAAAAATAAAATGCCTAGG No data
Right 1194520383 X:94910879-94910901 GCCTAGGAATGCAGCCAACCAGG No data
1194520380_1194520383 25 Left 1194520380 X:94910831-94910853 CCAAATCAGGAACACAATTTCAT No data
Right 1194520383 X:94910879-94910901 GCCTAGGAATGCAGCCAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194520383 Original CRISPR GCCTAGGAATGCAGCCAACC AGG Intergenic
No off target data available for this crispr