ID: 1194521079

View in Genome Browser
Species Human (GRCh38)
Location X:94919407-94919429
Sequence AGTTATCTGCAAAAGATGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194521079_1194521083 22 Left 1194521079 X:94919407-94919429 CCTGTCATCTTTTGCAGATAACT No data
Right 1194521083 X:94919452-94919474 CTTGACCTGTTACTAGGCCTTGG No data
1194521079_1194521082 16 Left 1194521079 X:94919407-94919429 CCTGTCATCTTTTGCAGATAACT No data
Right 1194521082 X:94919446-94919468 ACATCTCTTGACCTGTTACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194521079 Original CRISPR AGTTATCTGCAAAAGATGAC AGG (reversed) Intergenic
No off target data available for this crispr