ID: 1194521374

View in Genome Browser
Species Human (GRCh38)
Location X:94922305-94922327
Sequence CTTCAATAGCATTTAGGTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194521372_1194521374 29 Left 1194521372 X:94922253-94922275 CCTTATGTAACATTAGATTTATC No data
Right 1194521374 X:94922305-94922327 CTTCAATAGCATTTAGGTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194521374 Original CRISPR CTTCAATAGCATTTAGGTTA AGG Intergenic
No off target data available for this crispr