ID: 1194521820

View in Genome Browser
Species Human (GRCh38)
Location X:94928801-94928823
Sequence GTGAAAAATGCAATCACTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194521815_1194521820 28 Left 1194521815 X:94928750-94928772 CCATTTATTGAAAAGATTGTCTT No data
Right 1194521820 X:94928801-94928823 GTGAAAAATGCAATCACTGTAGG No data
1194521818_1194521820 1 Left 1194521818 X:94928777-94928799 CCAATAAATGTTCTTGGCACCTT No data
Right 1194521820 X:94928801-94928823 GTGAAAAATGCAATCACTGTAGG No data
1194521817_1194521820 2 Left 1194521817 X:94928776-94928798 CCCAATAAATGTTCTTGGCACCT No data
Right 1194521820 X:94928801-94928823 GTGAAAAATGCAATCACTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194521820 Original CRISPR GTGAAAAATGCAATCACTGT AGG Intergenic
No off target data available for this crispr