ID: 1194528745

View in Genome Browser
Species Human (GRCh38)
Location X:95016095-95016117
Sequence CTGTCCCAACAGCTAGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194528745_1194528750 12 Left 1194528745 X:95016095-95016117 CCTCTCTCTAGCTGTTGGGACAG No data
Right 1194528750 X:95016130-95016152 CCGTTTCTTTTCATCCTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194528745 Original CRISPR CTGTCCCAACAGCTAGAGAG AGG (reversed) Intergenic
No off target data available for this crispr