ID: 1194528745 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:95016095-95016117 |
| Sequence | CTGTCCCAACAGCTAGAGAG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1194528745_1194528750 | 12 | Left | 1194528745 | X:95016095-95016117 | CCTCTCTCTAGCTGTTGGGACAG | No data | ||
| Right | 1194528750 | X:95016130-95016152 | CCGTTTCTTTTCATCCTACAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1194528745 | Original CRISPR | CTGTCCCAACAGCTAGAGAG AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||