ID: 1194530037

View in Genome Browser
Species Human (GRCh38)
Location X:95035917-95035939
Sequence GTTCATCAGCACCATGCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194530037_1194530040 30 Left 1194530037 X:95035917-95035939 CCTACAGCATGGTGCTGATGAAC No data
Right 1194530040 X:95035970-95035992 AACTACAGAGCAGAGTTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194530037 Original CRISPR GTTCATCAGCACCATGCTGT AGG (reversed) Intergenic