ID: 1194532478

View in Genome Browser
Species Human (GRCh38)
Location X:95068715-95068737
Sequence ACCAATGTCCTACACTGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194532478_1194532484 16 Left 1194532478 X:95068715-95068737 CCACAGCAGTGTAGGACATTGGT No data
Right 1194532484 X:95068754-95068776 CCTTTCCAGGCACTAGCTCTTGG No data
1194532478_1194532485 17 Left 1194532478 X:95068715-95068737 CCACAGCAGTGTAGGACATTGGT No data
Right 1194532485 X:95068755-95068777 CTTTCCAGGCACTAGCTCTTGGG No data
1194532478_1194532480 3 Left 1194532478 X:95068715-95068737 CCACAGCAGTGTAGGACATTGGT No data
Right 1194532480 X:95068741-95068763 AGTCATGAGGACCCCTTTCCAGG No data
1194532478_1194532479 -10 Left 1194532478 X:95068715-95068737 CCACAGCAGTGTAGGACATTGGT No data
Right 1194532479 X:95068728-95068750 GGACATTGGTCAGAGTCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194532478 Original CRISPR ACCAATGTCCTACACTGCTG TGG (reversed) Intergenic
No off target data available for this crispr