ID: 1194534843

View in Genome Browser
Species Human (GRCh38)
Location X:95093992-95094014
Sequence TGTGAACCAATTGTTGCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194534843_1194534846 6 Left 1194534843 X:95093992-95094014 CCCACAGCAACAATTGGTTCACA No data
Right 1194534846 X:95094021-95094043 CATTGACAAAAGTGTCTTTGTGG No data
1194534843_1194534848 16 Left 1194534843 X:95093992-95094014 CCCACAGCAACAATTGGTTCACA No data
Right 1194534848 X:95094031-95094053 AGTGTCTTTGTGGGAGTTTTCGG No data
1194534843_1194534849 23 Left 1194534843 X:95093992-95094014 CCCACAGCAACAATTGGTTCACA No data
Right 1194534849 X:95094038-95094060 TTGTGGGAGTTTTCGGATTTAGG No data
1194534843_1194534847 7 Left 1194534843 X:95093992-95094014 CCCACAGCAACAATTGGTTCACA No data
Right 1194534847 X:95094022-95094044 ATTGACAAAAGTGTCTTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194534843 Original CRISPR TGTGAACCAATTGTTGCTGT GGG (reversed) Intergenic
No off target data available for this crispr