ID: 1194534847

View in Genome Browser
Species Human (GRCh38)
Location X:95094022-95094044
Sequence ATTGACAAAAGTGTCTTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194534844_1194534847 6 Left 1194534844 X:95093993-95094015 CCACAGCAACAATTGGTTCACAG No data
Right 1194534847 X:95094022-95094044 ATTGACAAAAGTGTCTTTGTGGG No data
1194534843_1194534847 7 Left 1194534843 X:95093992-95094014 CCCACAGCAACAATTGGTTCACA No data
Right 1194534847 X:95094022-95094044 ATTGACAAAAGTGTCTTTGTGGG No data
1194534842_1194534847 10 Left 1194534842 X:95093989-95094011 CCACCCACAGCAACAATTGGTTC No data
Right 1194534847 X:95094022-95094044 ATTGACAAAAGTGTCTTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194534847 Original CRISPR ATTGACAAAAGTGTCTTTGT GGG Intergenic
No off target data available for this crispr