ID: 1194543563

View in Genome Browser
Species Human (GRCh38)
Location X:95204731-95204753
Sequence AGTTATCTGCAGCAGGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194543563_1194543566 3 Left 1194543563 X:95204731-95204753 CCATGTTCCTGCTGCAGATAACT No data
Right 1194543566 X:95204757-95204779 CAGAGCCCATCCCTTTGTTTTGG 0: 26
1: 51
2: 34
3: 22
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194543563 Original CRISPR AGTTATCTGCAGCAGGAACA TGG (reversed) Intergenic
No off target data available for this crispr