ID: 1194545019

View in Genome Browser
Species Human (GRCh38)
Location X:95223097-95223119
Sequence TCTAAGCTTCAGTAAATATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194545018_1194545019 -2 Left 1194545018 X:95223076-95223098 CCACACTGCTTTAGATGCAAATC No data
Right 1194545019 X:95223097-95223119 TCTAAGCTTCAGTAAATATAAGG No data
1194545017_1194545019 10 Left 1194545017 X:95223064-95223086 CCATCTGAAAATCCACACTGCTT No data
Right 1194545019 X:95223097-95223119 TCTAAGCTTCAGTAAATATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194545019 Original CRISPR TCTAAGCTTCAGTAAATATA AGG Intergenic
No off target data available for this crispr