ID: 1194545019 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:95223097-95223119 |
Sequence | TCTAAGCTTCAGTAAATATA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1194545018_1194545019 | -2 | Left | 1194545018 | X:95223076-95223098 | CCACACTGCTTTAGATGCAAATC | No data | ||
Right | 1194545019 | X:95223097-95223119 | TCTAAGCTTCAGTAAATATAAGG | No data | ||||
1194545017_1194545019 | 10 | Left | 1194545017 | X:95223064-95223086 | CCATCTGAAAATCCACACTGCTT | No data | ||
Right | 1194545019 | X:95223097-95223119 | TCTAAGCTTCAGTAAATATAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1194545019 | Original CRISPR | TCTAAGCTTCAGTAAATATA AGG | Intergenic | ||
No off target data available for this crispr |