ID: 1194552527

View in Genome Browser
Species Human (GRCh38)
Location X:95319645-95319667
Sequence CCCTGGTGCCACCTGTCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194552520_1194552527 1 Left 1194552520 X:95319621-95319643 CCCGTCTCCACTTTCATTTCTGG No data
Right 1194552527 X:95319645-95319667 CCCTGGTGCCACCTGTCTGCTGG No data
1194552522_1194552527 0 Left 1194552522 X:95319622-95319644 CCGTCTCCACTTTCATTTCTGGC No data
Right 1194552527 X:95319645-95319667 CCCTGGTGCCACCTGTCTGCTGG No data
1194552523_1194552527 -6 Left 1194552523 X:95319628-95319650 CCACTTTCATTTCTGGCCCCTGG No data
Right 1194552527 X:95319645-95319667 CCCTGGTGCCACCTGTCTGCTGG No data
1194552519_1194552527 2 Left 1194552519 X:95319620-95319642 CCCCGTCTCCACTTTCATTTCTG No data
Right 1194552527 X:95319645-95319667 CCCTGGTGCCACCTGTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194552527 Original CRISPR CCCTGGTGCCACCTGTCTGC TGG Intergenic
No off target data available for this crispr