ID: 1194558688

View in Genome Browser
Species Human (GRCh38)
Location X:95394140-95394162
Sequence CTGGAGCCCTAGGGTTTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194558682_1194558688 21 Left 1194558682 X:95394096-95394118 CCAGGGGAAACTGGATGCCTGGC No data
Right 1194558688 X:95394140-95394162 CTGGAGCCCTAGGGTTTTGATGG No data
1194558678_1194558688 29 Left 1194558678 X:95394088-95394110 CCCCAGAGCCAGGGGAAACTGGA No data
Right 1194558688 X:95394140-95394162 CTGGAGCCCTAGGGTTTTGATGG No data
1194558684_1194558688 4 Left 1194558684 X:95394113-95394135 CCTGGCTGGCTTCAACACTTGCT No data
Right 1194558688 X:95394140-95394162 CTGGAGCCCTAGGGTTTTGATGG No data
1194558680_1194558688 27 Left 1194558680 X:95394090-95394112 CCAGAGCCAGGGGAAACTGGATG No data
Right 1194558688 X:95394140-95394162 CTGGAGCCCTAGGGTTTTGATGG No data
1194558679_1194558688 28 Left 1194558679 X:95394089-95394111 CCCAGAGCCAGGGGAAACTGGAT No data
Right 1194558688 X:95394140-95394162 CTGGAGCCCTAGGGTTTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194558688 Original CRISPR CTGGAGCCCTAGGGTTTTGA TGG Intergenic
No off target data available for this crispr