ID: 1194566973

View in Genome Browser
Species Human (GRCh38)
Location X:95501283-95501305
Sequence GCTTATGGATCCCGTCACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194566973_1194566976 0 Left 1194566973 X:95501283-95501305 CCAGGGTGACGGGATCCATAAGC No data
Right 1194566976 X:95501306-95501328 CAAACCACAGCATCATGCAATGG No data
1194566973_1194566978 8 Left 1194566973 X:95501283-95501305 CCAGGGTGACGGGATCCATAAGC No data
Right 1194566978 X:95501314-95501336 AGCATCATGCAATGGTCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194566973 Original CRISPR GCTTATGGATCCCGTCACCC TGG (reversed) Intergenic
No off target data available for this crispr