ID: 1194567763

View in Genome Browser
Species Human (GRCh38)
Location X:95514536-95514558
Sequence CTAATCTATTTCAGTCACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194567763_1194567770 24 Left 1194567763 X:95514536-95514558 CCTCAGTGACTGAAATAGATTAG No data
Right 1194567770 X:95514583-95514605 CCTTCTTTATACTATTCCAGGGG No data
1194567763_1194567767 22 Left 1194567763 X:95514536-95514558 CCTCAGTGACTGAAATAGATTAG No data
Right 1194567767 X:95514581-95514603 GTCCTTCTTTATACTATTCCAGG No data
1194567763_1194567765 0 Left 1194567763 X:95514536-95514558 CCTCAGTGACTGAAATAGATTAG No data
Right 1194567765 X:95514559-95514581 GACCAAGATTTATCTACTTCTGG No data
1194567763_1194567768 23 Left 1194567763 X:95514536-95514558 CCTCAGTGACTGAAATAGATTAG No data
Right 1194567768 X:95514582-95514604 TCCTTCTTTATACTATTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194567763 Original CRISPR CTAATCTATTTCAGTCACTG AGG (reversed) Intergenic
No off target data available for this crispr