ID: 1194567765

View in Genome Browser
Species Human (GRCh38)
Location X:95514559-95514581
Sequence GACCAAGATTTATCTACTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194567763_1194567765 0 Left 1194567763 X:95514536-95514558 CCTCAGTGACTGAAATAGATTAG No data
Right 1194567765 X:95514559-95514581 GACCAAGATTTATCTACTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194567765 Original CRISPR GACCAAGATTTATCTACTTC TGG Intergenic
No off target data available for this crispr