ID: 1194570312

View in Genome Browser
Species Human (GRCh38)
Location X:95547972-95547994
Sequence ATGTAAAGACCATCGAGACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194570312_1194570315 2 Left 1194570312 X:95547972-95547994 CCTAGTCTCGATGGTCTTTACAT No data
Right 1194570315 X:95547997-95548019 TGGCATGATTTTGCAGCGGCTGG No data
1194570312_1194570318 29 Left 1194570312 X:95547972-95547994 CCTAGTCTCGATGGTCTTTACAT No data
Right 1194570318 X:95548024-95548046 GGTTGTTCCTTTCCACGTTTAGG No data
1194570312_1194570316 8 Left 1194570312 X:95547972-95547994 CCTAGTCTCGATGGTCTTTACAT No data
Right 1194570316 X:95548003-95548025 GATTTTGCAGCGGCTGGTACCGG No data
1194570312_1194570314 -2 Left 1194570312 X:95547972-95547994 CCTAGTCTCGATGGTCTTTACAT No data
Right 1194570314 X:95547993-95548015 ATTTTGGCATGATTTTGCAGCGG No data
1194570312_1194570319 30 Left 1194570312 X:95547972-95547994 CCTAGTCTCGATGGTCTTTACAT No data
Right 1194570319 X:95548025-95548047 GTTGTTCCTTTCCACGTTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194570312 Original CRISPR ATGTAAAGACCATCGAGACT AGG (reversed) Intergenic