ID: 1194570318

View in Genome Browser
Species Human (GRCh38)
Location X:95548024-95548046
Sequence GGTTGTTCCTTTCCACGTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194570312_1194570318 29 Left 1194570312 X:95547972-95547994 CCTAGTCTCGATGGTCTTTACAT No data
Right 1194570318 X:95548024-95548046 GGTTGTTCCTTTCCACGTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194570318 Original CRISPR GGTTGTTCCTTTCCACGTTT AGG Intergenic