ID: 1194573895

View in Genome Browser
Species Human (GRCh38)
Location X:95587438-95587460
Sequence ACCTTTCCAAGCGTCAGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194573895_1194573897 9 Left 1194573895 X:95587438-95587460 CCTGAGCTGACGCTTGGAAAGGT No data
Right 1194573897 X:95587470-95587492 ACTCCTGCTGAAACCACCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194573895 Original CRISPR ACCTTTCCAAGCGTCAGCTC AGG (reversed) Intergenic
No off target data available for this crispr