ID: 1194581980

View in Genome Browser
Species Human (GRCh38)
Location X:95684595-95684617
Sequence GGCAGAGCTGCATTCCTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194581980_1194581983 20 Left 1194581980 X:95684595-95684617 CCAGAAAGGAATGCAGCTCTGCC No data
Right 1194581983 X:95684638-95684660 ATGAGACTCATTTGATCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194581980 Original CRISPR GGCAGAGCTGCATTCCTTTC TGG (reversed) Intergenic
No off target data available for this crispr