ID: 1194585523

View in Genome Browser
Species Human (GRCh38)
Location X:95729006-95729028
Sequence GTGCCTGTTTTCACTTGATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194585521_1194585523 27 Left 1194585521 X:95728956-95728978 CCGAGCATTCTGCATGTATATTA No data
Right 1194585523 X:95729006-95729028 GTGCCTGTTTTCACTTGATCAGG No data
1194585522_1194585523 -6 Left 1194585522 X:95728989-95729011 CCTTTTGAATTCTGTTTGTGCCT No data
Right 1194585523 X:95729006-95729028 GTGCCTGTTTTCACTTGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194585523 Original CRISPR GTGCCTGTTTTCACTTGATC AGG Intergenic
No off target data available for this crispr