ID: 1194585685

View in Genome Browser
Species Human (GRCh38)
Location X:95731115-95731137
Sequence CTGGAGTCCTTGAGGTAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194585681_1194585685 25 Left 1194585681 X:95731067-95731089 CCTCTGTTTTCCAAAAACTGTCA No data
Right 1194585685 X:95731115-95731137 CTGGAGTCCTTGAGGTAAGCAGG No data
1194585682_1194585685 15 Left 1194585682 X:95731077-95731099 CCAAAAACTGTCACTAATCACTA No data
Right 1194585685 X:95731115-95731137 CTGGAGTCCTTGAGGTAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194585685 Original CRISPR CTGGAGTCCTTGAGGTAAGC AGG Intergenic
No off target data available for this crispr