ID: 1194589163

View in Genome Browser
Species Human (GRCh38)
Location X:95775512-95775534
Sequence GTGGATAATGCCTCCTTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194589161_1194589163 -6 Left 1194589161 X:95775495-95775517 CCAGGTGACATCAAATGGTGGAT No data
Right 1194589163 X:95775512-95775534 GTGGATAATGCCTCCTTTGTGGG No data
1194589157_1194589163 16 Left 1194589157 X:95775473-95775495 CCTTGAATGTTGAATTGTTCTTC No data
Right 1194589163 X:95775512-95775534 GTGGATAATGCCTCCTTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194589163 Original CRISPR GTGGATAATGCCTCCTTTGT GGG Intergenic
No off target data available for this crispr