ID: 1194596647

View in Genome Browser
Species Human (GRCh38)
Location X:95867600-95867622
Sequence GCCCTATGGTGTGGGTTCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194596647_1194596651 -5 Left 1194596647 X:95867600-95867622 CCTGCGAACCCACACCATAGGGC No data
Right 1194596651 X:95867618-95867640 AGGGCCTAGCGTCCCAACCCTGG No data
1194596647_1194596657 27 Left 1194596647 X:95867600-95867622 CCTGCGAACCCACACCATAGGGC No data
Right 1194596657 X:95867650-95867672 ACTCTTAACAGTCTCTCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194596647 Original CRISPR GCCCTATGGTGTGGGTTCGC AGG (reversed) Intergenic
No off target data available for this crispr