ID: 1194604236

View in Genome Browser
Species Human (GRCh38)
Location X:95960853-95960875
Sequence TGGTGGTAGGTTGATTATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194604236_1194604242 1 Left 1194604236 X:95960853-95960875 CCAATATAATCAACCTACCACCA No data
Right 1194604242 X:95960877-95960899 GTAGCTGGCTGATCACCCCGAGG 0: 46
1: 172
2: 184
3: 149
4: 125
1194604236_1194604246 19 Left 1194604236 X:95960853-95960875 CCAATATAATCAACCTACCACCA No data
Right 1194604246 X:95960895-95960917 CGAGGAACGTTGCCATATTGAGG No data
1194604236_1194604247 20 Left 1194604236 X:95960853-95960875 CCAATATAATCAACCTACCACCA No data
Right 1194604247 X:95960896-95960918 GAGGAACGTTGCCATATTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194604236 Original CRISPR TGGTGGTAGGTTGATTATAT TGG (reversed) Intergenic
No off target data available for this crispr