ID: 1194604239

View in Genome Browser
Species Human (GRCh38)
Location X:95960866-95960888
Sequence TCAGCCAGCTACCTGGTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194604239_1194604247 7 Left 1194604239 X:95960866-95960888 CCTACCACCAGGTAGCTGGCTGA No data
Right 1194604247 X:95960896-95960918 GAGGAACGTTGCCATATTGAGGG No data
1194604239_1194604249 18 Left 1194604239 X:95960866-95960888 CCTACCACCAGGTAGCTGGCTGA No data
Right 1194604249 X:95960907-95960929 CCATATTGAGGGCTCAGTGTTGG 0: 55
1: 133
2: 202
3: 173
4: 255
1194604239_1194604246 6 Left 1194604239 X:95960866-95960888 CCTACCACCAGGTAGCTGGCTGA No data
Right 1194604246 X:95960895-95960917 CGAGGAACGTTGCCATATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194604239 Original CRISPR TCAGCCAGCTACCTGGTGGT AGG (reversed) Intergenic
No off target data available for this crispr