ID: 1194604241

View in Genome Browser
Species Human (GRCh38)
Location X:95960873-95960895
Sequence GGGGTGATCAGCCAGCTACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 907
Summary {0: 88, 1: 205, 2: 207, 3: 161, 4: 246}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194604241_1194604247 0 Left 1194604241 X:95960873-95960895 CCAGGTAGCTGGCTGATCACCCC 0: 88
1: 205
2: 207
3: 161
4: 246
Right 1194604247 X:95960896-95960918 GAGGAACGTTGCCATATTGAGGG No data
1194604241_1194604250 24 Left 1194604241 X:95960873-95960895 CCAGGTAGCTGGCTGATCACCCC 0: 88
1: 205
2: 207
3: 161
4: 246
Right 1194604250 X:95960920-95960942 TCAGTGTTGGTCTCTGCTGCTGG 0: 209
1: 251
2: 193
3: 172
4: 358
1194604241_1194604249 11 Left 1194604241 X:95960873-95960895 CCAGGTAGCTGGCTGATCACCCC 0: 88
1: 205
2: 207
3: 161
4: 246
Right 1194604249 X:95960907-95960929 CCATATTGAGGGCTCAGTGTTGG 0: 55
1: 133
2: 202
3: 173
4: 255
1194604241_1194604246 -1 Left 1194604241 X:95960873-95960895 CCAGGTAGCTGGCTGATCACCCC 0: 88
1: 205
2: 207
3: 161
4: 246
Right 1194604246 X:95960895-95960917 CGAGGAACGTTGCCATATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194604241 Original CRISPR GGGGTGATCAGCCAGCTACC TGG (reversed) Intergenic
901903774 1:12390667-12390689 TGGGTGATCAGCCAGCTACCTGG - Intronic
902018913 1:13329025-13329047 GGGGGGATCAGCCCCCTGCCTGG + Intergenic
902018989 1:13329201-13329223 GGGGGGATCAGCCCCCTGCCTGG + Intergenic
902626281 1:17678221-17678243 GGGTTGGGCAGCCAGCCACCTGG - Intronic
903637593 1:24833149-24833171 GGGGGGATCAGCCCCCTGCCTGG - Intronic
903637669 1:24833325-24833347 GGGGGGATCAGCCCCCTGCCTGG - Intronic
904179300 1:28654648-28654670 GAGGTGATCATCCAGCCACTTGG - Intergenic
904336080 1:29798997-29799019 GCAGTGATCAGCCAGCTACCTGG + Intergenic
905354215 1:37369791-37369813 GGTGTGATCAGCCAGCCACCTGG + Intergenic
905465375 1:38149112-38149134 GGGGTGATCAGCCAGCTACCTGG + Intergenic
906050632 1:42868418-42868440 GGGGTGATCAGCCAGCTACCTGG + Intergenic
906054795 1:42907142-42907164 AGGATGATCAGCCAGCTACCTGG - Intergenic
906867896 1:49442031-49442053 AGGGTGATCAGCCAGCTACCTGG + Intronic
906930778 1:50167516-50167538 GGGGTGATTAGCCGGCTACCTGG - Intronic
907780482 1:57561844-57561866 GCAGTGATCAGGCAGCTACCTGG + Intronic
908052459 1:60247720-60247742 GGGGTGATCAGCCAGCTACCTGG + Intergenic
908370378 1:63473668-63473690 GGGGGGATCAGCCCCCTGCCTGG + Intronic
908370508 1:63473970-63473992 GGGGGGATCAGCCCCCCACCTGG + Intronic
908370531 1:63474019-63474041 GGGGGGATCAGCCACCCGCCCGG + Intronic
908737532 1:67291822-67291844 GGGGTGATCAGCCAGCTACCTGG + Intergenic
909032745 1:70561287-70561309 AGGATGATCAGCCAGCTACTTGG - Intergenic
909172462 1:72314459-72314481 AGGATGATTAGCCAGCTACCTGG - Intergenic
909278856 1:73723110-73723132 TGGGTGATCAACCAGCTTCCTGG + Intergenic
909548808 1:76876189-76876211 GGGGTGATCAGCCAGCTACCTGG - Intronic
909577073 1:77186862-77186884 GGCATGATTAGGCAGCTACCTGG + Intronic
909811084 1:79932338-79932360 GAGGTGATCAACCAGCTACCTGG + Intergenic
909858775 1:80576037-80576059 GGGATGATCAGGCAGCTACTTGG - Intergenic
910141673 1:84033035-84033057 ATGGTAATCAGCCAGCTACCTGG + Intergenic
910349684 1:86281243-86281265 AGGGTGATCAGCCAGCTACCTGG + Intergenic
910370784 1:86513140-86513162 GGGGTGATCAGCCAGCTACCTGG + Intergenic
910562037 1:88600977-88600999 AGGGAGATCAGCCAGCTACCTGG + Intergenic
910565557 1:88639057-88639079 GGAGTGATCAGTTAGCTACCTGG - Intergenic
910588360 1:88902729-88902751 GGGGTGATCAGCCAGCCACCTGG + Intergenic
910630360 1:89347273-89347295 GGGGTGATCAGCCAGCTACTTGG + Intergenic
910830955 1:91462412-91462434 GGGGTGATCAACCAGCTACCTGG - Intergenic
910948354 1:92617717-92617739 ACGGTGATCAGCTAGCTACCTGG + Intronic
911109024 1:94163694-94163716 GGGGTGATCAGCAAGCTACCTGG - Intronic
911257196 1:95646353-95646375 GGGGTGATCAGCCAGCTACCTGG - Intergenic
911738253 1:101360922-101360944 GGGGTGATCAGGCAGCTACCTGG - Intergenic
911883713 1:103271471-103271493 GGGGAGATCAGCCAACTACCTGG + Intergenic
911974362 1:104472705-104472727 GGTGTGAGCAGCCAGCTATCTGG + Intergenic
911980558 1:104560432-104560454 GGGATAATCAGCCAGCTACTTGG + Intergenic
912050560 1:105523941-105523963 GGGGTGATTAGCCAGCTACCTGG - Intergenic
912067156 1:105757961-105757983 AGGGTGATCAGCCAGCTACCTGG + Intergenic
912251881 1:108020376-108020398 AAGGTGATCAGCCAGCTACCTGG - Intergenic
912533127 1:110340505-110340527 AGGATGATCAGCGAGCTAACCGG + Exonic
912733182 1:112127824-112127846 GGGGTGAGCAGCCAGCTACCTGG - Intergenic
912789837 1:112640139-112640161 GGGGGGATCAGCCCCCCACCCGG + Intronic
913039299 1:115007387-115007409 GGGGTGATTATCCAGCTACTTGG - Intergenic
913559301 1:120001591-120001613 AGGGTGATCAGCCAGCTACTTGG + Intronic
913638561 1:120788951-120788973 AGGGTGATCAGCCAGCTACTTGG - Intergenic
914279897 1:146161034-146161056 AGGGTGATCAGCCAGCTACTTGG + Intronic
914540935 1:148611952-148611974 AGGGTGATCAGCCAGCCACTTGG + Intronic
914625705 1:149459294-149459316 AGGGTGATCAGCCAGCTACTTGG - Intergenic
914965371 1:152252896-152252918 GGGGTTATCAGCCAGCTACTTGG - Intergenic
915667534 1:157458664-157458686 AGGGTGATCAGCTAGCTACCTGG - Intergenic
915703744 1:157823678-157823700 AGAGTAATCAGCCAGCTACCAGG - Intergenic
915709801 1:157884651-157884673 GGGGTGATCAGCCAGCTACTTGG + Intronic
916106053 1:161433289-161433311 GGGGTAATCAGCCAGCTACCTGG - Intergenic
916285472 1:163100528-163100550 GGGGTGATCAGCCAGCTACCTGG + Intergenic
917052374 1:170938809-170938831 AGAGTGATCAGCCAGCTACCTGG - Intronic
917217076 1:172689898-172689920 AGGGTGATCAGCAAGCTACCTGG - Intergenic
917462849 1:175247166-175247188 GGGGTGGTCAGCCAGCTACCTGG + Intergenic
917764681 1:178203020-178203042 TGGGTGATCAGCCAGCTAGTTGG + Intronic
918774640 1:188611756-188611778 TGGGTGATCAGCCAGCTACCTGG + Intergenic
918918094 1:190670876-190670898 GGGATGATCAGCTAGCTAGTTGG - Intergenic
918958378 1:191238943-191238965 GGGGTTATCAGCCAGCCACCTGG + Intergenic
919124233 1:193376958-193376980 GGGGTGGTCAGCCAGCTACTTGG - Intergenic
919241909 1:194925214-194925236 GGGGTGATCAGCCAGCTATCTGG + Intergenic
919318114 1:196000352-196000374 GGGTAGATCAGCCAGCTGCCTGG + Intergenic
919330346 1:196162936-196162958 GGGGTGATCAGCCAGCTACCTGG + Intergenic
920197577 1:204239365-204239387 GGGGTGAACAACCAGCTACCTGG + Intronic
921140121 1:212298690-212298712 GGGGGGATCAGCCCCCTGCCTGG - Intronic
921619925 1:217314114-217314136 GGGGTGATCAACCAGCTACCTGG + Intergenic
922638755 1:227205141-227205163 GAGGTACTCAGCCAGCTACTTGG + Intronic
923253432 1:232198439-232198461 GAGGTGATCAGCCAGCTACCTGG - Intergenic
923426590 1:233876212-233876234 GAGGTAATCTGCCAGCCACCTGG + Intergenic
923702157 1:236310379-236310401 AAGGTGACCAGCCAGCTACCAGG - Intergenic
923926047 1:238628800-238628822 GGGGGGATCAGCCAGCTACCTGG - Intergenic
924182393 1:241452233-241452255 TAGGTGATCAGCCAGCTACCTGG - Intergenic
924492099 1:244548416-244548438 GTGGTGATTAGCCAGCTACCTGG + Intronic
924829637 1:247579359-247579381 AGGGCGATCAGACAGCTACCAGG + Intergenic
924846999 1:247784135-247784157 GGGGTGAACAGCCAGCTACTTGG - Intergenic
1063788265 10:9409514-9409536 GGGGTGATCAGCCAGCTACCTGG + Intergenic
1064517445 10:16166793-16166815 AGGGTTATCAGCCAGCTGCCTGG - Intergenic
1066085639 10:31970562-31970584 GGGGGGATCAGCCCCCTGCCTGG + Intergenic
1066085716 10:31970738-31970760 GGGGGGATCAGCCCCCTGCCTGG + Intergenic
1066166881 10:32798219-32798241 GGGGTGATCAGCCAGCTACTTGG - Intronic
1066957757 10:42189065-42189087 CGGGTGATCGACCAGCTAGCCGG + Intergenic
1067125410 10:43511538-43511560 CGGGTGATCAGCCAGCTACCTGG - Intergenic
1067333285 10:45341228-45341250 GGGGTGATCAGTCTGTTACCTGG + Intergenic
1067754210 10:48992709-48992731 AGGATGATTAGTCAGCTACCTGG - Intergenic
1068005965 10:51392896-51392918 GGGGTGGTCAGCCCCCCACCCGG - Intronic
1068007528 10:51408571-51408593 GGGGTGATCAGCCAGCCACCTGG - Intronic
1068837074 10:61567371-61567393 AGGGTGATCAGCCAGCTACCTGG - Intergenic
1068856786 10:61805964-61805986 AGGGTGATCAGCCAGCTACCTGG + Intergenic
1068909031 10:62358633-62358655 GGGGTAATCAGTCAGCTCCCTGG + Intergenic
1069184740 10:65409164-65409186 GGGGTGATTAGCTAGCTACCTGG + Intergenic
1069209788 10:65741850-65741872 GGGGTAATCAGCCAACTACCTGG - Intergenic
1069790689 10:71018575-71018597 GGGGTGATCAGCCAGCTACCTGG - Intergenic
1071032878 10:81205724-81205746 AGAGTGATCAGCCAGCTATTTGG + Intergenic
1071074093 10:81730759-81730781 AGGGTAATCACCCAGCTATCTGG - Intergenic
1071266934 10:83972995-83973017 ATGGTGATCAGCCAGCTACCTGG - Intergenic
1071364342 10:84883514-84883536 AGGATGATCAGCTAGCTATCTGG - Intergenic
1071673774 10:87636417-87636439 GGGGTGATCAGCCAGCTACCTGG - Intergenic
1071937831 10:90550286-90550308 AGGGTGATCAATCAGCTACCTGG + Intergenic
1071942640 10:90606766-90606788 AGGGTGATCAGCCAGCTATCTGG - Intergenic
1072180398 10:92975566-92975588 GGGGGGATCAGCCCCCTGCCCGG + Intronic
1072360602 10:94655095-94655117 GGGGTGATCAGCCAGCTACCTGG + Intergenic
1073000076 10:100278160-100278182 GGGGGGGTCAGCCCCCTACCCGG + Intronic
1073557495 10:104466902-104466924 GGGGTGATCAGCCAGCTACCTGG + Intergenic
1073656537 10:105423483-105423505 AGGGTGATCAGCCAGCTACTTGG - Intergenic
1073830384 10:107377000-107377022 TGGGTGATGAGCCAGCTACCTGG - Intergenic
1073995736 10:109313777-109313799 GGGGTGATCAGCCAGCTACCTGG - Intergenic
1074235529 10:111581108-111581130 AGGGTGCTCAGCTAGCTATCTGG - Intergenic
1074448148 10:113537391-113537413 GTGGTGAGCACCCAGCTACTTGG + Intergenic
1074632385 10:115273061-115273083 TAGGTAATCAGCCAGCTACCTGG - Intronic
1075324878 10:121523375-121523397 GGGGTGTCCAGCCAGCTGCTAGG - Intronic
1075606935 10:123818414-123818436 AGGGTGATCAGCCAGCTACCAGG + Intronic
1076123426 10:127954325-127954347 GGGGTGATCTGCCAGCCTCCTGG + Intronic
1076271460 10:129155832-129155854 AGAGTGATAAGCCAGTTACCTGG + Intergenic
1076772477 10:132673829-132673851 GGAGTGGTCAGCCAGCTACCTGG - Intronic
1076885749 10:133261696-133261718 GGGGGGGTCAGCGAGCAACCGGG + Intergenic
1076927262 10:133498207-133498229 AGGGTGGTCAGCCAGCTACCTGG - Intergenic
1080020024 11:27550673-27550695 AGGGTAATTAGCCAGCTACCTGG - Intergenic
1080076737 11:28158500-28158522 GGTGTGATCAGCCAGCTACCTGG + Intronic
1081065329 11:38533909-38533931 ATGGTGATCAGCCAGCTATGTGG - Intergenic
1081378427 11:42386912-42386934 GGGATGATCAGCCAGATACCTGG + Intergenic
1081609206 11:44548867-44548889 GGGGTGATCAGCCAGCTACCTGG + Intergenic
1081668022 11:44927842-44927864 GGGCTGATCACCCTGCTCCCAGG + Intronic
1081687691 11:45054152-45054174 GGGGTGATCTGTCAGCCAGCAGG - Intergenic
1082000572 11:47391815-47391837 GGGGTGCTCAGTCAGCCAGCTGG + Intergenic
1082671831 11:56044017-56044039 GGGATGATCAGCCAGCTAGCTGG + Intergenic
1083093275 11:60222105-60222127 GGAATGATCAGCCAGCTACTTGG + Intronic
1085023907 11:73225552-73225574 GGGATGGTCAGGCAGCTTCCTGG + Intronic
1085463586 11:76709688-76709710 GGGGCGATTAGCCACCTCCCAGG + Intergenic
1085686099 11:78623170-78623192 TGGGTGATCAGCCAGCTACCTGG + Intergenic
1086141488 11:83505218-83505240 AGGGTGATCAGCCAGCTACCTGG - Intronic
1086278747 11:85161437-85161459 AGGATGATCAGCCAGCTACCTGG + Intronic
1086446959 11:86879498-86879520 GGGGGGATCAGCCCCCCACCCGG + Intronic
1086834261 11:91601369-91601391 TGGGTGATCAGACAGCTACCTGG + Intergenic
1087374155 11:97321529-97321551 AGGGTGATCAGCCAGCTGCCTGG + Intergenic
1088038421 11:105347176-105347198 AGGGTGATCAGCCAGCTACCTGG + Intergenic
1088097350 11:106116139-106116161 AGGGTGATCAGCCAGCTACTTGG + Intergenic
1088111942 11:106271706-106271728 AGGGTGATCATCCAGCCACCAGG + Intergenic
1088191512 11:107233514-107233536 TGGGGCATCAGTCAGCTACCTGG - Intergenic
1088265563 11:107984585-107984607 AGGGTGATCAGCCAGCTACCTGG + Intergenic
1088407472 11:109497680-109497702 GGGGTGATCAGCCAACTACATGG - Intergenic
1088836798 11:113584365-113584387 AGGGTGATCAGCATGCTACCTGG + Intergenic
1089143100 11:116303484-116303506 AGAGGGATCAGCCAGCCACCTGG + Intergenic
1089903756 11:122014596-122014618 GGGGTGATCAGCCAGCCACTTGG + Intergenic
1090119053 11:124005410-124005432 GAGGTGATCAGCCAGCTACCTGG - Intergenic
1090197132 11:124826337-124826359 GGGGTGATCAGCCCGCTACTTGG - Intergenic
1090209346 11:124907072-124907094 GGGGTGATCAGGCAGCTACCTGG - Intergenic
1090413327 11:126523729-126523751 GGGGTAGCCAGCCAGCTACAAGG - Intronic
1090753874 11:129771617-129771639 AGGGTGATCATGCAGCCACCTGG - Intergenic
1091051885 11:132379739-132379761 AGGGCGATCAGCCAACTACCTGG + Intergenic
1091103605 11:132898199-132898221 AGGGCAATCAGCCAGCTACGTGG + Intronic
1091378654 12:42251-42273 GGGGGGATCAGCCCCCTGCCTGG + Intergenic
1091378730 12:42426-42448 GGGGGGATCAGCCCCCTGCCTGG + Intergenic
1092012302 12:5124618-5124640 GGAGTGAGAAGCCAGCTACCTGG - Intergenic
1092381690 12:8001908-8001930 GGGGTAATCAGCCAGCTACCTGG + Intergenic
1092922411 12:13244534-13244556 AGGATGATCAGCCAGCTACCTGG - Intergenic
1092931164 12:13317185-13317207 GGTGTAAACAGCCAGCTACATGG + Intergenic
1093031722 12:14294950-14294972 GGGGTGATCAGCCAGCTACCTGG - Intergenic
1093036487 12:14336661-14336683 GAGGTGATCAGCCAGCTACCTGG + Intergenic
1093048796 12:14484089-14484111 GGGGTGATCAGCTAGCTACCGGG - Intronic
1093049531 12:14489987-14490009 GGGGTGATCAGCTAGCTACCTGG - Intronic
1093645855 12:21584643-21584665 GGGGTGATCAGCCAGCTACCTGG + Intronic
1093964679 12:25311936-25311958 AAGGTAATCAGCCAGCTACGTGG + Intergenic
1093981465 12:25479814-25479836 CAGGGGATCAGCCAGCTACTTGG - Intronic
1094102673 12:26780247-26780269 GGGGTGATCGGCCAGCTCCCTGG + Intronic
1094389648 12:29935239-29935261 CAGGGGATCAGCCAGCAACCTGG - Intergenic
1095121372 12:38423854-38423876 AGGGTGATCAGCCAGCTACCTGG - Intergenic
1095844245 12:46728990-46729012 GGGGTGATCAGCCAGCTACCTGG - Intergenic
1096288915 12:50324235-50324257 CAGGTGATCAGCCAGCTACCTGG + Intergenic
1096457318 12:51798463-51798485 GGGGTGATCAGCCAGCTACTTGG - Intronic
1096735112 12:53647110-53647132 AGGGTGATAAGCCAGCTCCCTGG + Intronic
1097437691 12:59571279-59571301 GGGGTGATCAGCCAGCTACCTGG - Intergenic
1097554729 12:61122587-61122609 AGGGACATCAGCCAGCTACCTGG + Intergenic
1097564506 12:61251464-61251486 GGGGTGATCAGCCAGCTACCTGG - Intergenic
1097821210 12:64130925-64130947 AGGGTGATCAGCCAGCTACCTGG - Intronic
1097843208 12:64341767-64341789 GGGGTGATCAGCCAGCTACCTGG - Intronic
1098716237 12:73830789-73830811 AGGGTGATCAGCCAGCTACCTGG + Intergenic
1098731196 12:74038321-74038343 GGGGTGATCAGGCAGCTACCTGG + Intergenic
1098745813 12:74235568-74235590 GGGGTGACCAACCAGCTACCTGG + Intergenic
1098749975 12:74280581-74280603 AGGGTGATCAGCCAGCTACCTGG + Intergenic
1099183247 12:79491620-79491642 AGGGTGATCAGTTAGCTACCTGG - Intergenic
1099366068 12:81766365-81766387 AGGGTGATCAGCCAGCTACCTGG + Intergenic
1099375788 12:81894934-81894956 GGGGTGATCACCCAACTACCTGG + Intergenic
1099379253 12:81935563-81935585 AGGGTGATCAGCCAGCTACCTGG - Intergenic
1099401069 12:82204384-82204406 GGGGTGATCACCCTGCTACTTGG - Intergenic
1099578201 12:84406383-84406405 AGGGTGATCAACCAGCTACCTGG + Intergenic
1099689917 12:85939006-85939028 GGGATGATCAGCCAGCTATCTGG + Intergenic
1099700748 12:86078565-86078587 GGAGTGACAAGCCAACTACCTGG - Intronic
1099735926 12:86566020-86566042 GGGGTGATCAGCCAGCTACTTGG + Intronic
1099804311 12:87498639-87498661 AGGATAATCAGCCAGCTACTGGG - Intergenic
1100083444 12:90879191-90879213 GTGGTGATCAGACAGCTACCTGG + Intergenic
1100241000 12:92710622-92710644 GGGGTGATCAGACAGCTACCTGG - Intergenic
1100544758 12:95590974-95590996 GGGGTGATCAGCCAGCCACCTGG + Intergenic
1100570373 12:95840710-95840732 GGGGGGATCAGCCCCCTGCCTGG - Intergenic
1100570450 12:95840886-95840908 GGGGGGATCAGCCCCCTGCCTGG - Intergenic
1101534470 12:105604771-105604793 GGGGTGATCAGCCAGCTACCTGG - Intergenic
1101543208 12:105683619-105683641 GGGGTGATTAGTCAGCTACCTGG + Intergenic
1101697230 12:107138251-107138273 GGGGTGATCAGCCAACTACCTGG - Intergenic
1102043329 12:109814740-109814762 GGGGAGCTCAGCCACCTCCCCGG + Exonic
1103035765 12:117655057-117655079 AGGGTGATCAGCCAGCTACCTGG + Intronic
1103396673 12:120612432-120612454 AGGGTGATCAGCCAGCTACCTGG + Intergenic
1103641730 12:122357508-122357530 GGGGGGGTCAGCCCGCCACCCGG + Intronic
1103993101 12:124812220-124812242 GGGGTGATCTGCCATTTACCTGG - Intronic
1104147936 12:126053647-126053669 AGGGTGATCAACCAGCTACTTGG + Intergenic
1105428758 13:20318116-20318138 GGGGTGATCAGCCAGCTACCTGG + Intergenic
1105740257 13:23316165-23316187 GGGGTGATAAGCCAGCTACCTGG + Intronic
1106142779 13:27025230-27025252 GGGGTGATGAGCCAGGGGCCTGG - Intergenic
1106201781 13:27544187-27544209 GGGGTAATCAAGCATCTACCTGG + Intergenic
1107505302 13:41027556-41027578 GGGGTGATCCGCCAGCTACCTGG + Intronic
1107983442 13:45754986-45755008 GGAGTGATCAGCTAGCTACCTGG - Intergenic
1108904415 13:55450942-55450964 GGGATGATCAGCCAGCTACCTGG + Intergenic
1109366334 13:61361389-61361411 TTGCTGAGCAGCCAGCTACCAGG - Intergenic
1109392486 13:61710322-61710344 AGGGTGATCAGCCAGCTACCTGG + Intergenic
1109519165 13:63485786-63485808 GAGGTAATAAGCCAGCTACCTGG + Intergenic
1109583178 13:64367152-64367174 AGGGTGGTCAGCCAGCTACCTGG + Intergenic
1109680191 13:65741454-65741476 AGGGTAATCAGCTAGCTACCTGG - Intergenic
1109712546 13:66179849-66179871 AGGGTGATCAACCAGCTGCTTGG - Intergenic
1109928323 13:69177952-69177974 GGGGTGATCAGCCAGTTACCTGG + Intergenic
1109931946 13:69227244-69227266 GGTGCAATCAGCCAGCTACTTGG - Intergenic
1109933185 13:69244209-69244231 GGGGTAATCAGCTAGCTACCTGG - Intergenic
1110377301 13:74807496-74807518 AGTGTGATTAGCCAGCTACCTGG + Intergenic
1110815566 13:79856859-79856881 AGGATGATCAGCCAGCTATGTGG + Intergenic
1110833999 13:80063646-80063668 CGGGTGATCAGCCAGCTACCTGG - Intergenic
1111016317 13:82386902-82386924 AGGGTGATCAGCCAGCTACCTGG - Intergenic
1111057654 13:82972040-82972062 GGGGTGATCAGCCAGCTACCTGG - Intergenic
1111198673 13:84905871-84905893 GGGGTGAACAGCCAGCTAGTTGG + Intergenic
1111432136 13:88158792-88158814 AGGGTGATCACCCAGCTACCTGG - Intergenic
1111441016 13:88282725-88282747 GGGGTGATTAGCCAGCTACTTGG + Intergenic
1111535332 13:89596156-89596178 TGGGTGATCAGCCAGCTACCTGG + Intergenic
1112230981 13:97589186-97589208 GGGGTGATCAGCCTGCTACCTGG - Intergenic
1113111475 13:106828568-106828590 AGGGTAATCAGCCAGCTACCTGG - Intergenic
1113319560 13:109220689-109220711 AGGGTGATCAGCCAGCTACCTGG - Intergenic
1113396274 13:109950517-109950539 GGAGTGATCAGCCAGCTATCTGG + Intergenic
1113673169 13:112188728-112188750 GGCATGATCAGCCAGCTGCCTGG - Intergenic
1114206005 14:20571752-20571774 GGGGTGATCAGCCAGCTACCTGG + Intergenic
1114758113 14:25282895-25282917 AGGGTGATCCGCCAGCTACCTGG - Intergenic
1114896229 14:26994358-26994380 GGGGTGATCAGCTAGCTACTTGG - Intergenic
1115059844 14:29174867-29174889 AGGGTGATCAGCCAGCTACCTGG + Intergenic
1115310751 14:31975530-31975552 GGGGTGAGCAACCAGCTACTTGG - Intergenic
1115687064 14:35807541-35807563 CGAGTAGTCAGCCAGCTACCAGG - Intronic
1116059038 14:39897911-39897933 AGGGTGGTCAGCCAGCTACCTGG + Intergenic
1116068231 14:40010153-40010175 GGGGTGATCAGCCAGCCACCTGG + Intergenic
1116101404 14:40441774-40441796 GGAGTGATCAGCCAGCTACCTGG - Intergenic
1116158245 14:41235674-41235696 GGGGTGATCAGCCAGCTACCCGG - Intergenic
1116191984 14:41674640-41674662 GGGGGGATCAGCCCCCCACCTGG - Intronic
1116249184 14:42458619-42458641 GGGGTGATCATCCAGCTACTTGG + Intergenic
1116307930 14:43282475-43282497 TGGGTGATCAACCAGCTACCTGG - Intergenic
1116415204 14:44670279-44670301 AGGGTGATCAGCCAGCTACGTGG + Intergenic
1116531324 14:45977255-45977277 GGGGTGATAAGCCAGCTACTTGG - Intergenic
1117216992 14:53561159-53561181 GGGGTGATCAGCCAGCTACCTGG + Intergenic
1117596132 14:57328899-57328921 AGGGTGATCAGCCAGCTACCTGG - Intergenic
1117779981 14:59222423-59222445 AGGGTCATCAGCCAGCTAACTGG - Intronic
1118122298 14:62859194-62859216 TGGGTAATCAGCCCGCTACCTGG - Intronic
1118340868 14:64895014-64895036 GGGGGGATCAGCCCCCTGCCTGG - Intergenic
1118340945 14:64895190-64895212 GGGGGGATCAGCCCCCTGCCTGG - Intergenic
1118880633 14:69823035-69823057 GGGGTGATCAGCCAGCTACCTGG - Intergenic
1118907182 14:70031600-70031622 GGGGTGATAACCCAGCTACAGGG + Intronic
1118950611 14:70433589-70433611 GGGGTGATCAGCCAGCTACCTGG - Intergenic
1119107415 14:71937858-71937880 AGGGTGATCAGCCAGCTACCTGG - Intronic
1120081878 14:80226548-80226570 GGGGTGATCAGCCAGCTACCTGG - Intronic
1120919831 14:89744700-89744722 CAGGTGATCAGCCAGCTACCTGG + Intergenic
1120973841 14:90231782-90231804 GGGATGATCATTCAGCTACTTGG + Intergenic
1121263282 14:92581970-92581992 AGGGTGATCAGACAGCACCCGGG + Intronic
1121306610 14:92911457-92911479 GGGGGGATCAGCCCTCTGCCCGG - Intergenic
1122296510 14:100709137-100709159 GGTGAGAACAGCCAGCCACCTGG + Intergenic
1122568196 14:102676621-102676643 GGGGGGATCAGCCCCCCACCTGG - Intronic
1122841306 14:104465074-104465096 CAGGCGATCAGCCAGCTACCTGG - Intergenic
1122843871 14:104480169-104480191 GGGGTGAGCAGACACCTGCCAGG + Intronic
1202935347 14_KI270725v1_random:82711-82733 GGGGTGATCGACCAGCTACCCGG - Intergenic
1126125666 15:45293027-45293049 GGGGGGATCAGCCCCCCACCCGG - Intergenic
1126283740 15:46987239-46987261 AGGGTAATCAACCAGCTACCTGG + Intergenic
1126517065 15:49550147-49550169 GGGGGGATCAGCCCCCTGCCCGG - Intronic
1126703563 15:51387538-51387560 TGGATGAGCAGCCAGCTCCCAGG + Intronic
1127154141 15:56109964-56109986 GGGGGGATCAGCCCCCTGCCCGG + Intronic
1127598705 15:60513210-60513232 GGGCTGCTCAGGCAGCAACCAGG + Intronic
1128307360 15:66608245-66608267 GGGGAGATAGGACAGCTACCAGG - Intronic
1128642941 15:69353211-69353233 GGGGCGATCAGCCAGCTACCTGG + Intronic
1130377056 15:83338549-83338571 GGGGTGACCAGCTGCCTACCTGG + Intergenic
1130801432 15:87267565-87267587 GGGGCGATCAGGGAGGTACCTGG - Intergenic
1131724156 15:95203784-95203806 GGGTTGATCAGCAAGTTACTTGG + Intergenic
1132217741 15:100079616-100079638 GGGGTGATCAGCCAGCAACCTGG + Intronic
1132305609 15:100809912-100809934 GCGGTGTTCAGTCAGCTACCAGG - Intergenic
1133752045 16:8733014-8733036 GGGGGGATCAGCCCCCTGCCAGG - Intronic
1133828141 16:9297351-9297373 GGGGTGACCACTCAGATACCTGG - Intergenic
1134271950 16:12740661-12740683 GGGGTTTTCAGCCAGCTGCAGGG + Intronic
1135626141 16:23996483-23996505 GGGGTTATCAGCCAGCTACCTGG + Intronic
1136251084 16:29005553-29005575 GGGGTGACCAGTCAGCTACTTGG + Intergenic
1137661517 16:50210772-50210794 AGGGCAATCAGCCAGCTACAAGG - Intronic
1138263657 16:55643964-55643986 GGGTTCTTCTGCCAGCTACCTGG + Intergenic
1138519612 16:57563556-57563578 GGGGTGATCAGCTGGATCCCTGG + Intronic
1138719162 16:59058971-59058993 GGGGTAACCAGCAAGCTGCCTGG + Intergenic
1138791443 16:59908284-59908306 GGGAGGATCTGCCAGCTGCCTGG - Intergenic
1138868516 16:60851768-60851790 AGGGTGATCAGCCAGCTACCTGG + Intergenic
1140811431 16:78582670-78582692 GGGGTCATCAGTCACCCACCAGG - Intronic
1141559401 16:84857054-84857076 GGGGTGATCAGCCAGCTACCTGG - Intronic
1142579066 17:929572-929594 AGGGCGATCAACCAGCTAACAGG + Intronic
1142588082 17:987173-987195 GGGGTGATCAGCCAGTGACCCGG - Intergenic
1142588102 17:987239-987261 GGGGTGATCAGCCAGCGACCCGG - Intergenic
1142588131 17:987334-987356 GGGGTGATCAGCCAGCGACCCGG - Intergenic
1142588151 17:987400-987422 GGGGTGATCAGCCAGCGACCTGG - Intergenic
1142588201 17:987561-987583 GCGGTGATCAGCCAGCAACCCGG - Intergenic
1142695378 17:1629933-1629955 GGGGTGCTAAGCCAGCCCCCCGG - Intergenic
1145174161 17:20685241-20685263 GGGGGGGTCAGCCCGCTGCCCGG + Intergenic
1145733754 17:27212434-27212456 GGGGGGATCAGCCCCCTGCCTGG + Intergenic
1146758573 17:35455116-35455138 GGGGCGATCAGCCAGCCACCTGG + Intergenic
1146836497 17:36114959-36114981 AGGGTGATCAGCCAGCCACCTGG + Intergenic
1146851074 17:36222018-36222040 GGGGTGATCAGCCAGCCACCTGG + Intronic
1148393562 17:47290794-47290816 GGGGTGCTCCGGCAGCTTCCAGG + Intronic
1149255018 17:54816418-54816440 GGGGTGATCAGCCAGCTACCTGG + Intergenic
1149481812 17:57009567-57009589 GAAGAGATCAGCCGGCTACCTGG + Intergenic
1149795103 17:59511843-59511865 GGAGTGATCAGCTGTCTACCAGG + Intergenic
1150213940 17:63456654-63456676 GGGGCGATCAGCCCCCTGCCCGG + Intergenic
1150214060 17:63456928-63456950 GGGGGGATCAGCCCCCTGCCCGG + Intergenic
1152020307 17:77776893-77776915 GGGGGGATCAGCCCCCTGCCTGG + Intergenic
1153089853 18:1331144-1331166 GGGGTGATCAACCAGCTACCTGG + Intergenic
1153131135 18:1856741-1856763 GGGGTGATCAGCCAGCTACCTGG - Intergenic
1153217547 18:2834621-2834643 AGGGTGATCAACCAGCTACCTGG - Intergenic
1154068608 18:11132064-11132086 AGGGTGATCAGCCAGCTACCTGG + Intronic
1154252418 18:12755702-12755724 GGGGTGACCAGCCAGCTACCTGG - Intergenic
1154398184 18:14010702-14010724 GGGGGGGTCAGCCACCCACCCGG - Intergenic
1154506298 18:15043870-15043892 GGGGTGATCAACAAGCTACCTGG + Intergenic
1155234185 18:23803244-23803266 AGGGTAATCAGCTGGCTACCTGG - Intronic
1155336853 18:24773771-24773793 GGTGTGGTCAGACAGCTACCTGG - Intergenic
1156063968 18:33117473-33117495 GAGGTGACCAGTCAGCTACCTGG + Intronic
1156133438 18:34006493-34006515 GGGGTAACCAGCCAGCTATCTGG + Intronic
1156303995 18:35859676-35859698 AGGGTAATCAGTCAGCTACCTGG + Intergenic
1156546362 18:37967519-37967541 AGGGTGACCAGCCAGCTACCTGG + Intergenic
1156606507 18:38672733-38672755 GGGGTGATCAGCCAGTTACCTGG + Intergenic
1157341345 18:46780993-46781015 AGGGTGATCAGCCAGCTACCTGG + Intergenic
1157870800 18:51228614-51228636 AGGGTGATCATCCAGCTACCTGG - Intergenic
1157998361 18:52587143-52587165 AGGGTGATCAGCCAGCTACCTGG - Intronic
1159151763 18:64531714-64531736 AGGGTGATCAGCCAGCTAATTGG - Intergenic
1159287916 18:66376455-66376477 GGGGTGATCAGCCAGCTACCTGG + Intergenic
1159293401 18:66451009-66451031 TGACTGATCAGCCAGCTACTTGG - Intergenic
1159558962 18:69974382-69974404 GGGGTGATCGGCCAGCTACCTGG - Intergenic
1159711426 18:71765101-71765123 AGGGTGACCAGCCAGCTACTTGG + Intronic
1160092586 18:75840995-75841017 TGGGTGATTGGCCAGCTACTTGG + Intergenic
1163520406 19:17788342-17788364 GGGGTGGTCAGCCAGCACCAGGG - Exonic
1163691541 19:18741291-18741313 GGGCTGAGCTGCCAGCTCCCAGG - Intronic
1163697483 19:18771353-18771375 GGGCTGATCAGGCTGCTCCCGGG + Intronic
1164066744 19:21721836-21721858 GGGGGGATCAGCCCCCTGCCTGG + Intergenic
1164830231 19:31314446-31314468 GAGGTGAGCAGCCAGATAGCTGG - Intronic
1165497491 19:36162019-36162041 CTGGGGATCAGCCTGCTACCCGG - Intergenic
1166180161 19:41103107-41103129 GGGGGGATCGGCCCCCTACCCGG + Intergenic
1167951766 19:53033223-53033245 GGAGTGATCAGCCAGGTACTTGG + Intergenic
1168539189 19:57196424-57196446 GGGGTGATCAGCCAGCTACCTGG - Intronic
925105416 2:1286714-1286736 GGGGTGATCTGCCAGCTCCCTGG - Intronic
925280097 2:2677843-2677865 GGGGTGATCAGCCAGCTCCCTGG + Intergenic
925460862 2:4061425-4061447 GGAGTAATCAGCCAGCTCCCTGG + Intergenic
925499266 2:4485949-4485971 GGGGTGATAAGCCAGCTACCTGG - Intergenic
925772606 2:7298034-7298056 GGGGTGATCAGCCAGCTACTTGG - Intergenic
926826906 2:16914642-16914664 AGGGTGATCAGCCAGCTACCTGG + Intergenic
927008853 2:18880706-18880728 AGGGTAATCAGCCAGCTACCTGG + Intergenic
927660561 2:24989611-24989633 GGGGTGATCAGCCACCTACTTGG + Intergenic
927776898 2:25910432-25910454 GGGGGGATCAGCCCCCTGCCCGG - Intergenic
929269688 2:39959816-39959838 AGGGTGATCAGCCAGCTACTTGG - Intergenic
929915876 2:46135056-46135078 GGCGGGATCAACCAGGTACCAGG + Intronic
930295067 2:49544393-49544415 GGGGTGCTCAGCCAGGTACCTGG - Intergenic
930536485 2:52651284-52651306 GGGGTAATCAGCCAGCTATCTGG - Intergenic
930852162 2:55972919-55972941 CGAGTAATCAGCCAGCTACCTGG - Intergenic
930910273 2:56621846-56621868 GGGGTGATCATCCAGCTACCTGG + Intergenic
932870556 2:75394103-75394125 AGGGTGATCAGCCAGCTACGTGG - Intergenic
932975808 2:76598181-76598203 AGGGCGATCAGCCAGCTACCTGG + Intergenic
933265552 2:80177394-80177416 TGGGTAATCAACCAGCTACTTGG - Intronic
933394330 2:81712376-81712398 AGGGTGATCAGCCAGCTAGCTGG - Intergenic
933504645 2:83161787-83161809 GGGGCAATCAGCCAGCCACCTGG - Intergenic
933875916 2:86622579-86622601 TGGGGGAACAGCCAGGTACCAGG + Intronic
934305878 2:91821582-91821604 GGGGTGATGGACCAGCTACCCGG + Intergenic
934327378 2:92031160-92031182 GGGGTGATGGACCAGCTACCCGG - Intergenic
934465762 2:94261740-94261762 GGGGTGATCGACCAGCTACCCGG - Intergenic
934534676 2:95123011-95123033 TGGGGGCTCAGCCAGCTATCTGG - Intronic
935184086 2:100715879-100715901 AGGGTGATCAGCCAGCTACTTGG + Intergenic
935564163 2:104589275-104589297 GGGGTGATCAGCCAGCTACCTGG - Intergenic
935823345 2:106916169-106916191 GGGGTGATCAGCCACATACTTGG + Intergenic
936562909 2:113557336-113557358 CAAATGATCAGCCAGCTACCTGG - Intergenic
936641358 2:114315672-114315694 AGGCTGATCAGCCAGCTACTTGG + Intergenic
936818426 2:116488278-116488300 GGGATGATCAGCAAGCTACCTGG + Intergenic
937581927 2:123498167-123498189 GGGGTGATCAGCCAGCTACCTGG - Intergenic
937765773 2:125658966-125658988 AAGGTGATCATCCAGCTACTTGG + Intergenic
937785063 2:125886746-125886768 AGGGTGATCAGCCAGCTACCTGG - Intergenic
937852432 2:126647754-126647776 GGGGTGATTAGCCAGCTACCTGG - Intergenic
938088760 2:128418490-128418512 GGGGGGATCAGCCCCCTGCCTGG - Intergenic
938289216 2:130140593-130140615 TGGGTGACCAGCTAGCTGCCAGG + Intronic
938467310 2:131532345-131532367 TGGGTGACCAGCTAGCTGCCAGG - Intronic
938534036 2:132221692-132221714 GGGGGGATCAGCCCCCTGCCTGG + Intronic
939069222 2:137518868-137518890 AGGGTGATCGGCCAGCTACTTGG + Intronic
939214007 2:139213219-139213241 GGGGCGATCAGCCAGCTATCTGG + Intergenic
939806375 2:146779451-146779473 AGGGTGATCAGCCAGCTACTTGG + Intergenic
940171169 2:150831728-150831750 GGGGTGATCAGCTAGCTACCTGG - Intergenic
940359387 2:152781360-152781382 GGAGGGATCCGCCAGCTGCCTGG - Intergenic
940471957 2:154112138-154112160 GGGGTGATCAGCCAGCTACCTGG - Intronic
940544243 2:155062840-155062862 GGGATCATCAGCCAACTACCTGG - Intergenic
941330524 2:164173582-164173604 GGTGAGATCCGCCAGCTACCTGG - Intergenic
941668162 2:168262111-168262133 GAGGTGATCAGCCAGCTACCTGG + Intergenic
942322080 2:174744487-174744509 TGGGTGATCAGCCAGCTACCTGG + Intergenic
943182230 2:184559605-184559627 GGGGTGATCAGCCAGCTACTTGG + Intergenic
943207483 2:184919276-184919298 GGAATGATCAGCCAGCTGCCTGG - Intronic
943323675 2:186473572-186473594 GGGGGGATCAGCCCCCTGCCCGG + Intergenic
943383929 2:187180111-187180133 GGGGTGATCAGCCAGCTACCTGG - Intergenic
943480469 2:188411291-188411313 AGGCTGATCAGCCAGCTACTTGG - Intronic
943517454 2:188906274-188906296 GGGGTGATCAGCCAGCTACCTGG - Intergenic
943833477 2:192490175-192490197 AGGGTGATCAGACAGCTACCTGG - Intergenic
944598472 2:201282934-201282956 GGGGGGATCAGCCCCCTGCCTGG - Intronic
945544995 2:211139091-211139113 AGGGTGATCAGCCAGCTACCTGG + Intergenic
945642320 2:212444819-212444841 AGGGTGATCAGCCAGCTACCTGG + Intronic
945725708 2:213470520-213470542 AGGGTGATCAACCAGCTACCTGG - Intronic
945835666 2:214835209-214835231 GGGGGGATCAGCCCCCCACCTGG - Intergenic
945970160 2:216226111-216226133 GGGGGGATCAGCCCCCTTCCTGG - Intergenic
945970237 2:216226287-216226309 GGGGGGATCAGCCCCCTGCCTGG - Intergenic
946527730 2:220539049-220539071 GGAGTGATCAGCCAGCTACCTGG - Intergenic
946703615 2:222436816-222436838 TGGGTGATCAGCCGGCTACCTGG - Intronic
946791049 2:223300734-223300756 GGGGTGATCAGACAGCTATTTGG + Intergenic
947440984 2:230121235-230121257 GGGGAGAACAGCCAGCTACCTGG + Intergenic
947949257 2:234133753-234133775 AGGGTGATCAGACAGCACCCGGG + Intergenic
948817895 2:240522561-240522583 GGGGTGGTGAGCTAGCTACCTGG + Intronic
1169086019 20:2824689-2824711 GGGGGGATCAGCCCCCTGCCTGG + Intergenic
1169086092 20:2824865-2824887 GGGGGGATCAGCCCCCTGCCTGG + Intergenic
1169610968 20:7379752-7379774 TTGTTGATCAGCCAGCTACCTGG - Intergenic
1170866511 20:20162468-20162490 GGGGTGATCAGGCAGAGATCTGG - Intronic
1171861354 20:30405309-30405331 GGGGTGATCAGCCCCCCACCTGG + Intergenic
1171957466 20:31471529-31471551 GGGGGGATCAGCCTCCTGCCCGG - Intronic
1173300309 20:41796605-41796627 AGGGAGATCAGCCAGCTACCTGG - Intergenic
1173758628 20:45540162-45540184 GAGGTGAGGAGCCAGTTACCTGG + Intronic
1174919120 20:54683110-54683132 GGAGTGTGCAGCCAGCTAGCGGG + Intergenic
1175141586 20:56864792-56864814 GGGGTCCTCAGCCTGGTACCTGG + Intergenic
1175848570 20:62073537-62073559 GGGGTGATCAGCCAGCTACTTGG + Intergenic
1176145473 20:63563476-63563498 GGGGTGCTCGGCCAGCTGCAGGG + Exonic
1176145681 20:63564413-63564435 GAGGTGATCAGGCAGCACCCGGG - Exonic
1176155527 20:63618207-63618229 GGTGTGAACATCCAGCTAGCAGG + Intronic
1176596767 21:8704947-8704969 GGGGTGATCGACCAGCTACCCGG - Intergenic
1176791556 21:13325153-13325175 GGGGTGATCAACAAGCTACCTGG - Intergenic
1176998306 21:15581249-15581271 AGGGTGATCAGCCAGCTACTTGG + Intergenic
1177139279 21:17341283-17341305 GGGGTGATCAGCCAGCTACCTGG - Intergenic
1177505423 21:22013223-22013245 GGGGTGATCAGCAAGCCACCTGG - Intergenic
1177780841 21:25621147-25621169 AGGGTGATCAGCCAGCTACCTGG - Intergenic
1177913315 21:27057191-27057213 AAGATGATCAGCCAGCTACCTGG + Intergenic
1177990230 21:28028162-28028184 GGGGTGATCAACCAGCTACCTGG + Intergenic
1178005903 21:28219451-28219473 GGGGTGATCAGCCAGCTACTTGG - Intergenic
1178012802 21:28306161-28306183 GGGGTGATCAGCCAGCTACCTGG + Intergenic
1179367244 21:40769806-40769828 AGGGTGATCAGACAACCACCTGG - Intronic
1179398157 21:41060112-41060134 GGGGTGATCAGCCATGTCCAAGG - Intergenic
1179415002 21:41191555-41191577 GGGGTGATCAGCCAGCTACCTGG - Intronic
1180279687 22:10682389-10682411 GGGGTGATCGACCAGCTACCCGG - Intergenic
1180591010 22:16937385-16937407 GTGGTGAGCGGCCAGCTACCTGG - Intergenic
1180639094 22:17283613-17283635 GAGGAGACTAGCCAGCTACCTGG - Intergenic
1181108488 22:20588231-20588253 TGGGTGACCAGCTAGCTGCCAGG + Intergenic
1181367252 22:22387549-22387571 AGGGTTATCAGCCAGCTACCTGG - Intergenic
1181373573 22:22438181-22438203 GGGGTGATCAGCCAGCTATCTGG - Intergenic
1182418683 22:30238003-30238025 GAGGGGATCAGTCAGCTACTAGG + Intergenic
1182965849 22:34520280-34520302 TGGGTGATAAGCTAGCTACTTGG + Intergenic
1183368002 22:37417386-37417408 GGGGTGGAGAGCCAGCTTCCAGG - Intronic
1183859921 22:40662379-40662401 AGTGTGGTCAGCCAGCTACGTGG + Intergenic
1183871471 22:40745024-40745046 GGGGGGATCAGCCCCCTGCCTGG - Intergenic
1184603421 22:45557384-45557406 GGGGTGATCAGCCAGCTACCTGG - Intronic
1185033765 22:48460169-48460191 GGGGTGATCAGCCAGCTACCTGG + Intergenic
949125525 3:442130-442152 GGGGTGATCAGCCAGCTACTTGG - Intergenic
949169897 3:985619-985641 AGGGTAATCAGCCAGCTACCTGG - Intergenic
949445753 3:4132040-4132062 AGGGTGATCAGCCAGCTACCTGG + Intronic
949639047 3:6014497-6014519 GGGGTGATCAGCTAGCTACCTGG + Intergenic
950949062 3:16980083-16980105 GGGGTGGTCAGCCCCCTACCTGG - Intronic
951003706 3:17593468-17593490 AGGGTGATCAGCCAGCTACCTGG + Intronic
951086691 3:18520244-18520266 GGGGTGATCAGCCAGCCACCTGG + Intergenic
951291383 3:20875761-20875783 AGGGTGATCAGCCAGCTACCTGG - Intergenic
951384656 3:22028500-22028522 GGGGTGATCAGCCAGCTACCTGG + Intronic
951970626 3:28440905-28440927 GGGGTGATCAGCCAGCTACCTGG - Intronic
951978921 3:28544446-28544468 GGGGTGATCTGCCAGCTTCTTGG + Intergenic
952601156 3:35084917-35084939 AGGGTGGTCAGGCAGCTACGTGG - Intergenic
953652647 3:44821067-44821089 GGGGGGGTCAGCCCGCCACCCGG - Intronic
954054301 3:48008920-48008942 TGGGTGATCAGCCAGCTACCTGG + Intronic
955362801 3:58289853-58289875 GGGGGGGTCAGCCCCCTACCCGG - Intronic
955418494 3:58714876-58714898 CGGCAGATCAGCCAGCTACCTGG - Intergenic
956047782 3:65214848-65214870 TCGGTGATCAACCAGCTACTTGG + Intergenic
956307003 3:67836612-67836634 GGGATGATCAGACAGCTGTCTGG + Intergenic
956509808 3:69981347-69981369 GCGGTGATCAACCAGGTACCTGG + Intergenic
956703761 3:71981920-71981942 GGGGTGATCAGCCAGCTACCTGG - Intergenic
957247433 3:77732918-77732940 TGGGTGATCTGCTAGCTACCTGG - Intergenic
957421730 3:79980096-79980118 TGGCTGATCAGCCAGTTACCTGG - Intergenic
957754726 3:84470408-84470430 GGAGTGATCAGCCAGCCACCTGG + Intergenic
958258874 3:91355750-91355772 AGGGTGATCAGCCAGTGTCCTGG - Intergenic
958487540 3:94731492-94731514 AGGGTGATCAGCCTGCTACCTGG - Intergenic
958581448 3:96030931-96030953 GGGGTAATCAGACAACTACCTGG + Intergenic
958667509 3:97159954-97159976 AGGGTGATCAGCTAGTTACCTGG - Intronic
958845647 3:99261441-99261463 GGGAAGATCAGCCAGCTACCTGG - Intergenic
958934448 3:100241593-100241615 AGGGTGATCAGCCAGCTACCTGG + Intergenic
959226639 3:103596299-103596321 GGGTTGATCAGCCTGCTACTCGG - Intergenic
959377323 3:105602709-105602731 GGGGTGATCAGCCAGCTACCTGG - Intergenic
959439648 3:106360165-106360187 GGGGTGATCAGCCAGCTACCTGG + Intergenic
959745873 3:109776294-109776316 GGGGTGATCAGGCAGCTACCTGG - Intergenic
959998009 3:112699301-112699323 GGGGTGATCAGCCAGCTACCTGG + Intergenic
960125963 3:113998671-113998693 AGGGTGATCAGGAAGCTACCCGG + Intronic
960494601 3:118359775-118359797 GGGGTGATCAGCCAGTTACCTGG - Intergenic
960906033 3:122602404-122602426 TGGGAGATCAGGCAGATACCAGG + Intronic
961262993 3:125617369-125617391 GGGGTGATCAGCCAGCTACCTGG + Intergenic
961710840 3:128827037-128827059 AGGGTGATCAGCCAGTTTCTTGG - Intergenic
962572223 3:136723607-136723629 GGGGGGATCAGCCCCCTGCCCGG + Intronic
963331666 3:143922392-143922414 GGGGTGATCAGCCAGCTACCCGG - Intergenic
963355523 3:144205886-144205908 GGGGTGATCAGCCAGCAACCTGG - Intergenic
963379103 3:144506302-144506324 GGGGTAATCAGCCAGCCACCTGG - Intergenic
963420692 3:145057320-145057342 GGGGTAATAAGCCAACTACTTGG + Intergenic
963465030 3:145668659-145668681 GAGATGATCAGCCAGCTTTCTGG + Intergenic
963548643 3:146693997-146694019 GGCATGATCAGCCTGCTACCTGG - Intergenic
963630445 3:147724202-147724224 TGGGTGATCAGCCAGCTACCTGG + Intergenic
963970175 3:151420972-151420994 AGGGTGATCAGCCAGCTACATGG - Intronic
964297805 3:155252902-155252924 AGCGTGATCAGCCAGATACCTGG + Intergenic
964679094 3:159317932-159317954 GGGATGACCAGCCAGCTACCTGG - Intronic
965099026 3:164273263-164273285 GGGGTGATCAGCCAGCTAACTGG + Intergenic
965226622 3:165999789-165999811 AGGGGGATCAGCCAGCTACCTGG - Intergenic
965291610 3:166888610-166888632 AGGGTGATCTGCCACCTACCTGG - Intergenic
965711525 3:171560372-171560394 TGGGTTAACAGCCAGCAACCTGG - Intergenic
966044191 3:175529938-175529960 GGGGTGATCAATTAGCTACCTGG - Intronic
966445827 3:179999541-179999563 GGGGTGATCAGCCAGCTACCTGG + Intronic
966763641 3:183438963-183438985 GAAGAGATCAGCCAGCTTCCTGG + Intergenic
967831930 3:193926962-193926984 AGGGTGATCAGCCAGCTACCTGG + Intergenic
967914270 3:194566733-194566755 AGGGTTATCAGACAGCTACCTGG - Intergenic
968800327 4:2739112-2739134 AGGGTGATCAGCCAGCTACCTGG + Intergenic
968907151 4:3459394-3459416 AGGGTGATCAGCCAGCTCCCCGG + Intergenic
970629426 4:17924484-17924506 GGGGTGATCAGCCAGCTACTTGG + Intronic
970644939 4:18108988-18109010 GGGGTAATCTGCCGGCTACTTGG - Intergenic
970941727 4:21641920-21641942 AGGGTGATCAGCCAGCTACCTGG + Intronic
971100879 4:23465439-23465461 AGGGTGATCAGCCAGCTACCTGG - Intergenic
971126571 4:23761289-23761311 GCGGTGATCAGACAGCTACTTGG + Intronic
971227487 4:24768530-24768552 GGAGTGATCATCCAGGTACAAGG + Intergenic
971687248 4:29786106-29786128 TGGGTGATCAGCCAGTTATCTGG - Intergenic
971857523 4:32061873-32061895 GAGGTGATCAGCCAGCTACTTGG - Intergenic
971897636 4:32618062-32618084 AGGACAATCAGCCAGCTACCTGG + Intergenic
971979166 4:33731892-33731914 AGGGTAATCAGCCAGCAACCTGG - Intergenic
972085355 4:35208067-35208089 AGGGTGATCAACCAGCTCCCTGG + Intergenic
972095617 4:35343673-35343695 AGGGTGATCAGCCAGCTGCCTGG + Intergenic
972201167 4:36716201-36716223 AGGGTGATCAGCCAGCTACCTGG - Intergenic
972806062 4:42530310-42530332 GGGGTGATCAGCCAGCCACCTGG + Intronic
972882835 4:43447191-43447213 GGGATGATCAGCCAGTTATCTGG - Intergenic
973130045 4:46638721-46638743 GTGGTGATCAACCAGCTACCTGG - Intergenic
973142287 4:46783346-46783368 TAAGAGATCAGCCAGCTACCTGG - Intronic
973672923 4:53237992-53238014 GGGGGGATCAGCCCCCTGCCCGG - Intronic
974243478 4:59283053-59283075 TGGGTGATCAGTCAACTACCTGG - Intergenic
974289702 4:59913721-59913743 AGGGTGATCAGCCAGCTACCTGG + Intergenic
974478917 4:62419910-62419932 AGGGTGATCAGCCAGCTACTTGG - Intergenic
974644481 4:64673803-64673825 AGGGTGATCAGCCAGCTACCTGG - Intergenic
974727359 4:65813520-65813542 AGGGTGATCAGCCAGCTACCTGG + Intergenic
975386582 4:73766531-73766553 GGGGTGATCAGCAAGCTACTTGG - Intergenic
975793632 4:77983832-77983854 GGGGGGATCAGCCCCCTGCCTGG - Intergenic
975982464 4:80176296-80176318 AGGGTGATCAGCCAGCTACCTGG - Intergenic
976034064 4:80794841-80794863 GGGGTGATCAGCCAACTACCTGG - Intronic
976896266 4:90115812-90115834 GGGGAGATCGGCCAGCTACCAGG + Intergenic
977031782 4:91892791-91892813 GAGTTGATCAGCCAACTACCTGG + Intergenic
977089347 4:92651249-92651271 AGAGTGATCAGCCAGCTACCTGG - Intronic
977204848 4:94156616-94156638 GGAGTGATGAACCAGCTACCTGG + Intergenic
977385006 4:96327573-96327595 GGGGTGATCAGCCTGCTACCTGG + Intergenic
977466145 4:97384357-97384379 AGGGTGATCAGCGAGCTACCTGG + Intronic
977489945 4:97699092-97699114 AGGGTGATCAGCCAACTACCTGG - Intronic
977701607 4:100028904-100028926 GGGGTGATCAGCCAGCTACCTGG - Intergenic
977833085 4:101616858-101616880 GGGGCAATAAGCCAGCTACCTGG - Intronic
977846984 4:101778282-101778304 GGGGTGATCACCCAGCTATCTGG - Intronic
977898849 4:102395567-102395589 GGGGTGATCAGCCAGCTACCTGG + Intronic
977930263 4:102742838-102742860 GGGGTGATCAGCCAGCTACCTGG - Intronic
977976454 4:103272360-103272382 AGGGTGATCAGCCAGCTACCTGG - Intergenic
978341438 4:107724567-107724589 CAGGAGATCAGCCAGCTACCTGG - Intergenic
978485786 4:109252246-109252268 AGGGTGATCAGCCAGCTACCTGG - Intronic
978772015 4:112466806-112466828 AGGGTGATCAGCCATCTATCTGG - Intergenic
978898931 4:113925846-113925868 ATGGTGATCAGCCAGCTACCTGG - Intronic
979595560 4:122530632-122530654 GGGGTGATCAGCCACCTACAAGG - Intergenic
979641577 4:123016200-123016222 GGGGGGATCAGCCCCCTGCCCGG - Intronic
979767146 4:124475577-124475599 GGGGTGATCAGCCAGCTACCTGG + Intergenic
979888437 4:126061200-126061222 ATGGTGATCAGCCAACTACCTGG - Intergenic
979898277 4:126188085-126188107 AGGGTGATCAGCCAGCTACTTGG - Intergenic
980245139 4:130229205-130229227 TGGGGAATCAGCCAGCTACCTGG - Intergenic
980283900 4:130757400-130757422 GAGGTGGTCAACCAGCTACCTGG + Intergenic
980385659 4:132086078-132086100 AGGGTGATCACCCAGCTACTTGG - Intergenic
980405751 4:132352808-132352830 GGGGTGATCAGCCAGCTACCTGG - Intergenic
980430732 4:132690160-132690182 GGGGTGAGCAGCCATGTACATGG - Intergenic
980582187 4:134769833-134769855 AGAGGGATTAGCCAGCTACCTGG - Intergenic
980602346 4:135040991-135041013 GGGGTGATCAGCCAGTTACCTGG + Intergenic
981462950 4:145032775-145032797 AGAGTGATCAGCCAGCTACCTGG + Intronic
981835139 4:149044920-149044942 AGGGTGATCAGCCAGCTACCTGG + Intergenic
981873675 4:149516179-149516201 AGGGTGATCAGCCAGCTACCTGG + Intergenic
982076392 4:151741551-151741573 GGGGAGATGAGCAAGCTGCCTGG + Intronic
982597635 4:157406072-157406094 GGGGTGATCAGATAGCTACTTGG - Intergenic
982623197 4:157731906-157731928 AGGGTGTTGAGCCAGCTACCTGG - Intergenic
982788097 4:159559415-159559437 AAGGTAATCAGCCAGCTACCTGG - Intergenic
982835687 4:160117627-160117649 GGAGTGTTCAGCCAGCTACCTGG + Intergenic
982847920 4:160275282-160275304 AGAGTGATCAGCCAGCTACCTGG + Intergenic
983027542 4:162756270-162756292 GGAGTGATCAGCCAGTTACCTGG + Intergenic
983417980 4:167482550-167482572 GGGGTGATCAGACATCAACTGGG - Intergenic
984060145 4:174981046-174981068 AGGGTAATCAGCTAGCTCCCTGG - Intergenic
984418129 4:179486696-179486718 GGGGCAATCAGCCAGCTCCCTGG - Intergenic
986036901 5:3949469-3949491 GGGGTGATCAGCCAGCTACCTGG - Intergenic
986087240 5:4463699-4463721 GGAGTGATAAGCCAGCTACCTGG + Intergenic
986531261 5:8739332-8739354 GGGGTGATCAGCCAGCTACCTGG - Intergenic
986766299 5:10931286-10931308 GGGGTGATCAGCCAGCTACCTGG + Intergenic
986938202 5:12917770-12917792 AGGGTGATCAGCCAGCTACTTGG - Intergenic
986959970 5:13200164-13200186 GGGGTGATCAGCCAGCTACCTGG + Intergenic
987153323 5:15062646-15062668 GGGGTGATCAGCCAGCTACCTGG + Intergenic
987281495 5:16418563-16418585 GTGGTGAACAGCCAGCCACATGG - Intergenic
987472689 5:18352059-18352081 GGGATAATCAGCCAGCTACCTGG + Intergenic
987504527 5:18750819-18750841 ATGGTGATCAGCCAGCTACCTGG + Intergenic
987646271 5:20676311-20676333 GGGGTGATCAGCCATCTACCTGG - Intergenic
987885587 5:23807482-23807504 GGGGTGATCAGCTAGCTACCTGG + Intergenic
987901467 5:24017821-24017843 AGGGTGGTCAGCCAGCTACCTGG - Intronic
988079693 5:26400448-26400470 GGGGTGATCAGCCAGCCACCTGG - Intergenic
988107891 5:26773523-26773545 AGGGTGATCAGCCAGCTACCTGG + Intergenic
988180004 5:27778293-27778315 GGGGTGATTAGCGTCCTACCAGG - Intergenic
988188920 5:27902224-27902246 AGGGTGAACTGCCTGCTACCTGG + Intergenic
988205162 5:28124371-28124393 GGGGTGATCAGCCAGCTACCTGG - Intergenic
988228892 5:28449107-28449129 AGGGTGATCAGCTAGCTACCTGG + Intergenic
988258302 5:28849525-28849547 GGGGTGATCAACCAGCTACCTGG + Intergenic
988562267 5:32291821-32291843 AGGGCGATCAGCCAGCTACCTGG + Intronic
988785385 5:34561932-34561954 GGGGTGATCAGCCAACTACCTGG - Intergenic
989045011 5:37266304-37266326 GGGGTGATCAGCAAGCTACCTGG - Intergenic
989307364 5:39973641-39973663 AGGGTGATCAGCAATCTACCTGG - Intergenic
989457508 5:41660786-41660808 GGGTAGATCAGCCAGATTCCTGG - Intergenic
991330600 5:65488700-65488722 GGGGTGATCAGCCAGCTACTTGG - Intergenic
991351807 5:65727034-65727056 GGGGTGTTCAGCCAACTTCTTGG + Intronic
991386678 5:66098620-66098642 GGAGTGTTTGGCCAGCTACCTGG + Intergenic
992109755 5:73481891-73481913 GGAGTGATCAGCCAGCTATCTGG - Intergenic
992243097 5:74790834-74790856 GGGGTGATCAGACAGCTAATTGG + Intronic
992290074 5:75271435-75271457 GGGGTGGTCAGCCCCCCACCCGG + Intergenic
992443033 5:76812522-76812544 GGGGGGATCAGCCCCCTGCCCGG + Intergenic
993319958 5:86459553-86459575 GGGGTGATCAGCAAGCTACCTGG + Intergenic
993367332 5:87049982-87050004 AGAGTGATCAGCCAGCTACCTGG - Intergenic
993412437 5:87590837-87590859 GGGGTAATCAACCAGCTACCTGG - Intergenic
993537647 5:89106311-89106333 AGAATGATCAACCAGCTACCTGG - Intergenic
993722609 5:91336465-91336487 GGGGTGGGCAGCCAGCTTCCAGG + Intergenic
993791916 5:92219889-92219911 AGAATGATCAGCCAGCTACCTGG + Intergenic
994917083 5:105994449-105994471 GGGGTGATCAGCCAGCTACCTGG + Intergenic
994984268 5:106914745-106914767 GGGGTGATCAGTCAGCTACCTGG - Intergenic
995037738 5:107554134-107554156 AGGGCGATCAGCCAGCTTTCTGG - Intronic
995269426 5:110204498-110204520 GGGGTGATAAGCCAGCTACGTGG - Intergenic
995427597 5:112042768-112042790 GGGGTGATCAGCCAGCTACTTGG - Intergenic
996018698 5:118568852-118568874 GGGGTGATCAGCCAGCTACTTGG + Intergenic
996164828 5:120211534-120211556 GGGATGATCAGCGAGATACTTGG - Intergenic
996392066 5:122972808-122972830 GGGGTGATCAGCCAGCTACTTGG - Intronic
996825705 5:127678809-127678831 GGGGTGATCAGCCAGATGCTTGG + Intergenic
996944260 5:129047802-129047824 AGGCTGATTAGCCAGCTACCTGG - Intergenic
998290190 5:140907571-140907593 AGGGTGATCAGCCAGCTACCTGG - Intronic
999286352 5:150396549-150396571 CGGGAGACCAGCCAGCTGCCAGG + Exonic
999351514 5:150875814-150875836 GGGGTGATCAGCCAGCTAGTTGG + Intronic
999524320 5:152386235-152386257 GTGCTGATAAGCCAGCTAGCTGG + Intergenic
1000159202 5:158582712-158582734 GGGGGGATCAGCCCCCCACCCGG + Intergenic
1000417111 5:160994883-160994905 GGGATGATCAGCCAGCTACCTGG + Intergenic
1001173747 5:169445622-169445644 GGGGTGATCAGCCAGCTACTTGG + Intergenic
1003695761 6:8405180-8405202 AGAGTGATCAGCCAGCTACCTGG - Intergenic
1003758753 6:9151067-9151089 GGGGTGATCAGCCAGCTACCTGG + Intergenic
1003791369 6:9551030-9551052 AGGGTGATCAGCCAGCCACCTGG + Intergenic
1004824152 6:19402252-19402274 TGGGTGATCTGCCAGCTATCTGG - Intergenic
1005185313 6:23158047-23158069 GTGGTGATCAGCCAGCTACCTGG + Intergenic
1005475091 6:26199869-26199891 GGCGTGCTTAGCCAGCTCCCCGG - Exonic
1005837434 6:29719209-29719231 GGGGGGATCAGCCCCCTGCCTGG + Intergenic
1005837510 6:29719384-29719406 GGGGGGATCAGCCCCCTGCCTGG + Intergenic
1006062483 6:31434186-31434208 TGGGCGATCAGCCAGCTACCTGG + Intergenic
1006064786 6:31454974-31454996 GGGGTGGTCAGCCCCCTGCCCGG - Intergenic
1006752175 6:36385542-36385564 GGGGGGATCTGCAAGCTGCCAGG - Exonic
1007809333 6:44475250-44475272 GCAGTGATCAGCTGGCTACCAGG + Intergenic
1008079247 6:47177587-47177609 GGGGTGACCAGCCAGCTACTTGG - Intergenic
1008340399 6:50357261-50357283 GGAGTCATCAGCCAGCCACTTGG + Intergenic
1008926292 6:56894470-56894492 GGGGGGATCAGCCCCCTGCCTGG - Intronic
1008996381 6:57664823-57664845 GGGGTGATCAGCCAGTGTCCTGG + Intergenic
1009184897 6:60563616-60563638 GTGGTGATCAGCCAGTGTCCTGG + Intergenic
1009660556 6:66605948-66605970 AGGGTGATCAGCCAGCAACTTGG - Intergenic
1009851779 6:69207975-69207997 TGGGTGATCAGCCAACTACCTGG - Intronic
1010107807 6:72189589-72189611 GGGGTGATCAGCCAGCTACTTGG - Intronic
1010323708 6:74541472-74541494 CGGGTGATCAGCCAGCTACCTGG + Intergenic
1010325188 6:74555618-74555640 GGGGTGATCAGCCAGCCACATGG - Intergenic
1010406858 6:75515882-75515904 GGGATGATCAGCCAGATATCTGG - Intergenic
1010750169 6:79608715-79608737 AGGGTGAGAAGCCAGCTTCCTGG - Intergenic
1010818769 6:80389391-80389413 AGGGTGATCAGTCAGCTACCTGG + Intergenic
1010831546 6:80536631-80536653 GGGGAGATCAGCAACCAACCTGG + Intergenic
1010938107 6:81885441-81885463 GGGATGATCAGCCAGCTACTTGG - Intergenic
1011039213 6:83012318-83012340 GGGGTGATCAGCCAGCTGTTTGG - Intronic
1011136520 6:84106419-84106441 GGGGTTATCAGTCAGCTACCTGG - Intergenic
1012002076 6:93665907-93665929 GAGGTGATTAGCCAGCTACATGG + Intergenic
1012288673 6:97423951-97423973 GGGATAATCAGCCAGCTATCTGG - Intergenic
1012511151 6:100003210-100003232 ATGGTTATCATCCAGCTACCTGG - Intergenic
1012730584 6:102875248-102875270 GGAGTGATCATCCAGCTACCTGG + Intergenic
1012820909 6:104083748-104083770 GGGGTGATCAGCCAGCTACCTGG + Intergenic
1012920648 6:105218566-105218588 AGGGTGATCAGCCAGCTACCTGG - Intergenic
1013098389 6:106966901-106966923 AGGGTAATCAGCCAGCTATGTGG + Intergenic
1014363262 6:120507366-120507388 GGGGTGATCAGCCAGCTACCTGG - Intergenic
1014417135 6:121196388-121196410 GGAGTGATCAGCCAGCTACCTGG + Intronic
1014446511 6:121534416-121534438 GAGGGGATCGGCCAGCCACCTGG - Intergenic
1014455862 6:121634504-121634526 GGGGTGATCAGCCAGCTACCTGG + Intergenic
1014631781 6:123797775-123797797 AGGGTTAGCAGCCAGCTACCTGG + Intergenic
1014763907 6:125388558-125388580 GGGGGGATCAGCCCCCTGCCTGG - Intergenic
1014763984 6:125388734-125388756 GGGGGGATCAGCCCCCTGCCTGG - Intergenic
1015095313 6:129408634-129408656 AGGGTGATCAGCCAGCTTCTTGG - Intronic
1015443146 6:133271580-133271602 GGGGTGATCAGCCAGCTACCTGG - Intronic
1015473080 6:133628521-133628543 AGGTTGATCAGCCAGCTACTTGG + Intergenic
1015475892 6:133658464-133658486 AGGGTGGTCAGCCAGCTACCTGG + Intergenic
1015527548 6:134187894-134187916 GGGGTGATCTGCCAGCCACCTGG - Intronic
1015862182 6:137692464-137692486 GGGGAGATCAGCCAGCTACCTGG + Intergenic
1016119796 6:140331711-140331733 AGGGTGATCAGCCAGCTACTTGG - Intergenic
1017043940 6:150329964-150329986 GGGCTGATCAGCCAGCTGCCTGG - Intergenic
1017227668 6:152040105-152040127 GGGGTGATCAGCCAGCTACTTGG - Intronic
1017976894 6:159366165-159366187 GGGGTGATCAGCCTGCTACCAGG - Intergenic
1018534893 6:164809523-164809545 GGGGTGATCACTCAGCTACTTGG - Intergenic
1018600025 6:165528483-165528505 AGGGTGATCAGCTAGCTACCTGG + Intronic
1018780975 6:167065071-167065093 GGGATGATCAGCCAGCTGGTTGG - Intergenic
1018954919 6:168403033-168403055 AGGGTGATCAGTCAGCTACTTGG - Intergenic
1019262173 7:87818-87840 GGAGTGCTCAGCCACCCACCAGG + Intergenic
1020583191 7:10031656-10031678 GGTATGATCAGCCTGCTCCCTGG - Intergenic
1021050845 7:15982277-15982299 GGGGTGACCAGCTAGTTACCTGG - Intergenic
1021724987 7:23540173-23540195 GGAGTTATCAGCCAGGAACCTGG - Intergenic
1021953788 7:25803207-25803229 GGGGTGATCAGGAAGGTACTGGG + Intergenic
1021988955 7:26123903-26123925 GGGGTAATCAGCCAGCTACCTGG + Intergenic
1022079028 7:27001312-27001334 AGGGTGATCAGCCAGCTACCTGG + Intergenic
1022083485 7:27045348-27045370 GGGGGGATCAGCCCCCTGCCCGG + Intergenic
1022498636 7:30868840-30868862 GGGGTGATGACCCAGCCTCCAGG - Intronic
1024032109 7:45469908-45469930 GGGGTGATCAACCAGCTTCCTGG + Intergenic
1024040683 7:45551128-45551150 GGGGTGATCATCAAGCTACCTGG + Intergenic
1024491706 7:49993662-49993684 ATGGTGATCAGCCAGCTACCTGG - Intronic
1024744351 7:52389406-52389428 GGGGTGATCAGCCAGCTGCTTGG + Intergenic
1024884213 7:54123664-54123686 GGGGTAATCAGCCAGTTTCTTGG - Intergenic
1026046350 7:66908131-66908153 TGGGTGATCACACAGCTACATGG - Intergenic
1026207724 7:68272704-68272726 GGGGTGATCAGCCAGCTACCTGG + Intergenic
1027406916 7:77872024-77872046 GGGGTGATCAGCCAGTTACCTGG - Intronic
1027546363 7:79531921-79531943 GGGCTGATCAGCCAACTACCTGG - Intergenic
1027685938 7:81278936-81278958 AGGGTGATCAGCCAGCTACTTGG + Intergenic
1027799873 7:82737378-82737400 CTGGTGATCAGCCAGCTACCTGG + Intergenic
1028043984 7:86092443-86092465 AGGGTGATCAGTCAGCTACCTGG + Intergenic
1028141871 7:87282971-87282993 GAGGTGATCAGCCAGCTACCTGG + Intergenic
1028237966 7:88383801-88383823 GGGGTGATCAGCCAGCTACCTGG + Intergenic
1028935154 7:96456046-96456068 GGGGTGATCAGCCAGCTACCTGG + Intergenic
1029279534 7:99427179-99427201 GGGGTGGTCAGCCCCCTGCCCGG + Intronic
1030277688 7:107737621-107737643 GGGGTGATCAGCCAGTTACCTGG + Intergenic
1030368900 7:108675021-108675043 GGGGTGATCAGCCAGCTACCTGG + Intergenic
1030457317 7:109792064-109792086 GGGGTGGTCAGCCAGCTACCTGG - Intergenic
1030883143 7:114905566-114905588 AGGGTGATCAGCCAGCTACCTGG - Intergenic
1030931148 7:115524701-115524723 CAGGTGTTCAGCCAGCTACCTGG - Intergenic
1031236996 7:119189232-119189254 GGGGTGATCAGCCAGCTACTTGG + Intergenic
1031474320 7:122204381-122204403 GGGGCGATCAGCCAGCTACCTGG - Intergenic
1031621557 7:123939834-123939856 GGGGTGATCAGACATCTCCTGGG - Intronic
1031676682 7:124619267-124619289 AGGGTGATCAGCCAGCTACTTGG + Intergenic
1031682168 7:124688329-124688351 GGCGTGATCAGCCAACTACTTGG + Intergenic
1031833143 7:126650997-126651019 GAGGTGATCAGCCATCTACCTGG + Intronic
1032152962 7:129445978-129446000 AGGGTGATCAGCCAGCTACCTGG - Intronic
1032923344 7:136575147-136575169 TGGGTGATCAGCCAGCTACGTGG - Intergenic
1033076405 7:138254028-138254050 GGGGGGATCAGCCAGTTACCTGG + Intergenic
1034234044 7:149554470-149554492 GGGGGGATCAGCCCCCCACCCGG + Intergenic
1035361404 7:158316087-158316109 GAGGTGATCAGCCAGCCGCCGGG + Intronic
1035554548 8:556429-556451 GGGGTGATCTGACAGTTTCCTGG + Intergenic
1036527131 8:9545853-9545875 GGGGTGATCAGCCAGTTACCTGG - Intergenic
1037364447 8:18107281-18107303 AAGGTAATCAGCCAGCTACCTGG - Intergenic
1037383297 8:18311263-18311285 GGGAAGATCAGCCAGTCACCTGG + Intergenic
1038454310 8:27662657-27662679 AGGGTAATCTGCCAGCTACCTGG - Intronic
1039292200 8:36108953-36108975 AGGGTGACCAGACAGCTACCTGG - Intergenic
1039324034 8:36465564-36465586 GGGGTGATCAGCCAGCTATCTGG - Intergenic
1039527122 8:38226772-38226794 GGGGTGATCAGCCAGCCACCTGG - Intronic
1039788757 8:40857057-40857079 GAGATGATCAGGAAGCTACCTGG + Intronic
1040710910 8:50187875-50187897 TGGGTGATCAGCCAGCTGCCTGG - Intronic
1041448080 8:57975550-57975572 AGGGTGATGAACCAGCTGCCTGG - Intergenic
1041986325 8:63925451-63925473 GGGGTGATCAGCCAGCTCTCTGG + Intergenic
1042000920 8:64123013-64123035 GGGGTGATCAGCCAGCTATGTGG - Intergenic
1042196205 8:66232765-66232787 GGGGGGATCAGCCCCCTGCCCGG + Intergenic
1042342556 8:67695368-67695390 AGGATGACCAGCCAGCTCCCTGG + Intronic
1044150934 8:88774051-88774073 GGAATGATCAGCCAGCTACCCGG + Intergenic
1044202527 8:89453469-89453491 AGCGTGATCAGCCAGCTACCTGG + Intergenic
1044285835 8:90411464-90411486 AGGGTGATCAGCCAACTACTTGG - Intergenic
1044487019 8:92766202-92766224 AGGGTGACCAGCCAGATACCTGG - Intergenic
1044609310 8:94076736-94076758 GGAGTGCTCAGCCTGCTACCAGG + Intergenic
1044633006 8:94297421-94297443 GGGGTGATCATCCAGCTACCTGG - Intergenic
1044895926 8:96891337-96891359 AGGGAGATCAGCCAGCTACTTGG - Intronic
1046128532 8:109940615-109940637 GGGGTGATCAGCCAGCTACCTGG - Intergenic
1046197688 8:110885182-110885204 GAGGTGATCAGCCAGCTACCTGG + Intergenic
1046585648 8:116146757-116146779 AGGGTGATCAGCCAGCTACCTGG - Intergenic
1047327330 8:123852330-123852352 GGGGTGACCAGCCAGCTACCTGG - Intronic
1048435707 8:134415292-134415314 TGGAGGATCAGCCAGCCACCAGG - Intergenic
1049889824 9:58363-58385 CAAATGATCAGCCAGCTACCTGG + Intergenic
1050045041 9:1534112-1534134 GGGGTGATCAGCTAGCTACCTGG + Intergenic
1050482820 9:6103578-6103600 GGGGTGATCAGCCAGCTACCTGG + Intergenic
1050901920 9:10960591-10960613 AGGGTGATCAGCCAGCAACATGG + Intergenic
1051475939 9:17509259-17509281 GGGGTGATCAGCCAGCTACCTGG + Intergenic
1051878292 9:21813393-21813415 GGGCTGAGTTGCCAGCTACCTGG + Intronic
1052227719 9:26109354-26109376 AAGGTGATCAGCCAGCTACTTGG + Intronic
1052368790 9:27641818-27641840 AGGGTGATCAGCCAGCTACCTGG + Intergenic
1052442126 9:28511314-28511336 AGGGTGATCAGTCAGCTACCTGG - Intronic
1052561434 9:30089018-30089040 GGGGTGATCAGCCAGCTACTTGG - Intergenic
1052577332 9:30306917-30306939 GGGCTGATCAGTCAGCTACCTGG + Intergenic
1052737201 9:32354596-32354618 AGGGTGATCAGCCAGCTACCTGG - Intergenic
1052865941 9:33464659-33464681 AGGGTGGTAAGCAAGCTACCTGG - Intronic
1052895368 9:33742657-33742679 AGGGTGATCACACAGCCACCTGG - Intergenic
1053610936 9:39712332-39712354 GGGGTAATAAGCCAGCTACCTGG + Intergenic
1053695824 9:40638520-40638542 GGGGTGATCGACCAGCTACCCGG - Intergenic
1053731304 9:41059638-41059660 CAAATGATCAGCCAGCTACCTGG + Intergenic
1053868978 9:42470354-42470376 GGGGTAATAAGCCAGCTACCTGG + Intergenic
1053942812 9:43269557-43269579 GGGGTGATCGACCAGCTACCCGG - Intergenic
1054087318 9:60758826-60758848 GGGGTAATAAGCCAGCTACCTGG - Intergenic
1054242586 9:62630063-62630085 GGGGTAATAAGCCAGCTACCTGG - Intergenic
1054307071 9:63437738-63437760 GGGGTGATCGACCAGCTACCCGG - Intergenic
1054405802 9:64761726-64761748 GGGGTGATCGACCAGCTACCCGG - Intergenic
1054439429 9:65247213-65247235 GGGGTGATCGACCAGCTACCCGG - Intergenic
1054490978 9:65774726-65774748 GGGGTGATCGACCAGCTACCCGG + Intergenic
1054556709 9:66664581-66664603 GGGGTAATAAGCCAGCTACCTGG - Intergenic
1055133834 9:72806211-72806233 GGGGTGGTCAGCCCCCTGCCCGG - Intronic
1055903799 9:81270213-81270235 GGGGTGATCAGCCAGCTACTTGG - Intergenic
1056156815 9:83846175-83846197 AGGGTGATCAGCGAGCTACCTGG + Intronic
1056314093 9:85371964-85371986 GGGGTCATCAGCCAGCTACCTGG - Intergenic
1056353720 9:85777351-85777373 AGGGTGATCGGCGAGCTACCTGG - Intergenic
1056525953 9:87443246-87443268 GGGGTGATCAGCCAGCTACCTGG - Intergenic
1057004810 9:91547819-91547841 ACGGTGATCCGCCAGCTACCTGG - Intergenic
1057059125 9:91987521-91987543 AGGGGGATCAGCAAGCTATCTGG + Intergenic
1057100454 9:92354281-92354303 GGGGTGATCAGCTAGCTACCTGG - Intronic
1058020047 9:100077042-100077064 AGGGTGATCAGCCAGCTACCTGG + Intronic
1058259126 9:102808707-102808729 TGGATGATCAGCCAGCTACCTGG - Intergenic
1058523061 9:105831177-105831199 AGGGTGATCAGCCAGCTACCTGG + Intergenic
1059196364 9:112374886-112374908 ATGGTGATAAGCCAGCTACCTGG - Intergenic
1059437828 9:114287170-114287192 GTGGTGATCAGCCACCAGCCTGG - Intronic
1059592594 9:115678215-115678237 GAGGTGGTCAGACAGCTACCTGG + Intergenic
1060783354 9:126430137-126430159 GGAGAGATGAGTCAGCTACCTGG - Intronic
1060804994 9:126569730-126569752 AGGGTGAACAGCCAGCTACTTGG - Intergenic
1061790367 9:133055896-133055918 CTGGTGACCAGCCAGCTCCCTGG + Intronic
1202778269 9_KI270717v1_random:12132-12154 GGGGTGATCGACCAGCTACCCGG - Intergenic
1186279649 X:7978098-7978120 GGGGTGACCAGCTAGCCACCTGG + Intergenic
1186469625 X:9811155-9811177 AGGGTGATCAGCCAGCTACCTGG - Intronic
1187524056 X:20038106-20038128 AAGGTGATCAGCCAACTACTTGG + Intronic
1189964072 X:46353824-46353846 GGAGTGACCAGCCAGCTATCTGG - Intergenic
1190040714 X:47069337-47069359 GTGGTGGGCACCCAGCTACCTGG + Intergenic
1190625221 X:52330893-52330915 AGGGTGATCATCCAGCTACCTGG - Intergenic
1190799254 X:53772716-53772738 GGGGGGATCAGCCCCCCACCTGG - Intergenic
1190996615 X:55616507-55616529 GGGGTGATCAGCCAGTTATCTGG - Intergenic
1191009185 X:55743355-55743377 AGGGTGATCAGCTAAGTACCTGG - Intronic
1191095580 X:56670209-56670231 GGTGTGATCAGCTACCTACTTGG - Intergenic
1191133909 X:57043539-57043561 AGGGTGATCAGCCAGCTACTTGG - Intergenic
1191629892 X:63311604-63311626 AGAGTGATTAGCCAGCTACCTGG - Intergenic
1191631411 X:63325846-63325868 GGGATAATCAGCAAGCTACCTGG + Intergenic
1191658659 X:63628828-63628850 AAGGTGATCAGCCAGCTACATGG - Intergenic
1191759493 X:64630876-64630898 GGGGTGATCAGCCAGCTACGTGG + Intergenic
1191933048 X:66395124-66395146 GGGGTTATCAGCCAGCTACCTGG + Intergenic
1191941125 X:66482898-66482920 GGGGTGATCAGCCAGCTATCTGG - Intergenic
1192107090 X:68326904-68326926 GGGGGGATCAGCCCCCTGCCTGG + Intronic
1192297577 X:69867048-69867070 GGGGTGATCAGCTAGCCACCTGG - Intronic
1192531573 X:71892188-71892210 GGAGTGATCAGGCAGCTACCTGG - Intergenic
1192661438 X:73046806-73046828 GTGGTGATCAGCCAGCTACTTGG - Intergenic
1192673121 X:73167429-73167451 GGGGTGATCTGCCAGCTGCCTGG - Intergenic
1192896417 X:75447197-75447219 GGGGTGATGAGCCATCAACCTGG + Intronic
1192898846 X:75472887-75472909 GGGGTGATCAGCCAGCTACCTGG + Intronic
1192996315 X:76516556-76516578 AGGGTGATCAGCCAGCTACTTGG + Intergenic
1193053628 X:77126747-77126769 TGGGTGATCAGCCAGCTACCTGG + Intergenic
1193288058 X:79737207-79737229 CAGGTGATCAGCAAGCTACTTGG + Intergenic
1193297909 X:79853636-79853658 AGGGTGATCAGCTACCTACCGGG + Intergenic
1193356384 X:80524120-80524142 TTGGTGATCAGCCAGCTACCTGG + Intergenic
1193447297 X:81619742-81619764 GGGGTGATCAGTCAGCTACTTGG + Intergenic
1193519228 X:82508675-82508697 AGGGTGATCAGCTAGCTACCTGG + Intergenic
1193833088 X:86311086-86311108 TGGGTAATCAGCCAGCTACCTGG + Intronic
1193876150 X:86864913-86864935 AGGGTGATCAGCCAGCTACCTGG + Intergenic
1193904614 X:87226798-87226820 GTGGTGATCAGCCTGCCACCAGG + Intergenic
1193914681 X:87350966-87350988 GGGGTGATCAGCCAGCTACTTGG - Intergenic
1193957427 X:87879197-87879219 AGGGTGATCAGCCGGCTACCTGG + Intergenic
1194163823 X:90489179-90489201 AGGGTGATCAGCCAGCTACCTGG - Intergenic
1194174760 X:90631808-90631830 CGGGTGATCAGCCAGCTACCTGG + Intergenic
1194179470 X:90694958-90694980 AGGGTGTTCAGCCAGTTATCTGG - Intergenic
1194210411 X:91063330-91063352 GGGGTGATCAGCCATCCACCTGG + Intergenic
1194232990 X:91347264-91347286 AGGGTGATCAGCCAGCTACTTGG + Intergenic
1194343449 X:92732063-92732085 TGGGTAATTAGCCAGCTACTTGG + Intergenic
1194443673 X:93962082-93962104 TGGGTGATCAGCCAGCCACCTGG + Intergenic
1194453976 X:94079862-94079884 TGGGTGATCAGCCAGCTACATGG - Intergenic
1194457087 X:94118465-94118487 GGGGTGATCAGACAGCTACCTGG + Intergenic
1194482770 X:94447110-94447132 AAAGTGATCAGCCAGCTACCTGG + Intergenic
1194513291 X:94821283-94821305 TGGGTGATCAGCCAGCTACCTGG - Intergenic
1194521200 X:94920418-94920440 GGGGTGATTAGCCAGCTACCTGG + Intergenic
1194584250 X:95714039-95714061 GGAGTGATCAGCAAGCTACCTGG + Intergenic
1194604241 X:95960873-95960895 GGGGTGATCAGCCAGCTACCTGG - Intergenic
1194834088 X:98659775-98659797 GGGGTGATCAGCAAGCTACCTGG + Intergenic
1194849110 X:98851187-98851209 GGGGTGGTCAGCTAGCTACCCGG - Intergenic
1194870828 X:99128845-99128867 GGGGTGATCAACCAGCTACCCGG + Intergenic
1195262785 X:103149955-103149977 AGGGTGAACAGTCAGCTACCTGG + Intergenic
1195748790 X:108144382-108144404 AGGGTGATCAGCCAGCTACCTGG - Intronic
1195782213 X:108478895-108478917 GGGGTGACCAGCCAGCTACCTGG - Intronic
1195783929 X:108495956-108495978 GGAGTGATCAGCCAACTCTCTGG + Intronic
1195809654 X:108815869-108815891 GGGGTGATCAGCCTGCTACCTGG - Intergenic
1195872295 X:109499103-109499125 GGGAGGACCAGCTAGCTACCTGG - Intergenic
1197002426 X:121453895-121453917 TGGGTGATCAGCCAGCTGCCTGG + Intergenic
1197044554 X:121979288-121979310 AGGGTGATCAGCCAGCTACTTGG + Intergenic
1197097544 X:122613392-122613414 AAGGTGATCAGCCAGCTACCCGG + Intergenic
1197182236 X:123548761-123548783 AGGGTGATCAGCCAGCTACCTGG + Intergenic
1197244909 X:124158022-124158044 TGGGTGATCAACCAACTACCTGG - Intronic
1197371913 X:125636886-125636908 GGGGTGATCAGCCAGCTACTTGG - Intergenic
1197386643 X:125811269-125811291 GGAGTGATCAGCCAGCTACCTGG - Intergenic
1197405181 X:126039921-126039943 GGGGTGATCACCCAGCTACCTGG + Intergenic
1197409187 X:126095467-126095489 GGGGTGATCAGCCAGCTAGCTGG - Intergenic
1197420014 X:126227311-126227333 AGGGTGATCAGCCTGCTGCCTGG + Intergenic
1197500949 X:127242132-127242154 AGGGATATCAGCCAGCTACCTGG + Intergenic
1197534805 X:127674402-127674424 TGGATGATCAGCCAGCTAGTGGG + Intergenic
1197592013 X:128420365-128420387 GGGGTGATCAGCCAGCTACCTGG + Intergenic
1198066967 X:133107783-133107805 ATGGTGACCAGCCAGCTACCTGG + Intergenic
1198701442 X:139401277-139401299 AGGGTGATCAGCCAGCTACCTGG + Intergenic
1198782901 X:140256831-140256853 GGGGTGATCAGCCAGCTACCTGG - Intergenic
1199008630 X:142731928-142731950 AGGGTGATCAGCTAGCTACGTGG + Intergenic
1199144323 X:144347997-144348019 AGGGTGATCAGCCGGCTACCTGG - Intergenic
1199310289 X:146313422-146313444 AGGGTGATCAGGCAGCTACTTGG - Intergenic
1200278037 X:154752352-154752374 GGGGGGACCAGACAGCCACCTGG - Intergenic
1200289522 X:154858383-154858405 AGGATGATCAGCCAGCTATCTGG + Intronic
1200340340 X:155389662-155389684 GGGGTGATCAGCGAGCTATCTGG - Intergenic
1200510086 Y:4066988-4067010 AGGGTGATCAGCCAGCTACCTGG - Intergenic
1200521405 Y:4212997-4213019 AGGGTGATCAGCCAGCTACCTGG + Intergenic
1200526134 Y:4277131-4277153 AGGGTGTTCAGCCAGTTATCTGG - Intergenic
1200651803 Y:5848728-5848750 TGGGTAATTAGCCAGCTACTTGG + Intergenic
1201193582 Y:11470436-11470458 GGGGTGATCGACGAGCTACCCGG - Intergenic
1201796534 Y:17902657-17902679 GGGGTGATCAGCCAGCTACCTGG - Intergenic
1201805021 Y:18003328-18003350 GGGGTGATCAGCCAGCTACCTGG + Intergenic
1202357919 Y:24071719-24071741 GGGGTGATCAGCCAGCTACCTGG - Intergenic
1202512859 Y:25598394-25598416 GGGGTGATCAGCCAGCTACCTGG + Intergenic