ID: 1194604246

View in Genome Browser
Species Human (GRCh38)
Location X:95960895-95960917
Sequence CGAGGAACGTTGCCATATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194604236_1194604246 19 Left 1194604236 X:95960853-95960875 CCAATATAATCAACCTACCACCA No data
Right 1194604246 X:95960895-95960917 CGAGGAACGTTGCCATATTGAGG No data
1194604240_1194604246 2 Left 1194604240 X:95960870-95960892 CCACCAGGTAGCTGGCTGATCAC 0: 165
1: 218
2: 182
3: 147
4: 198
Right 1194604246 X:95960895-95960917 CGAGGAACGTTGCCATATTGAGG No data
1194604241_1194604246 -1 Left 1194604241 X:95960873-95960895 CCAGGTAGCTGGCTGATCACCCC 0: 88
1: 205
2: 207
3: 161
4: 246
Right 1194604246 X:95960895-95960917 CGAGGAACGTTGCCATATTGAGG No data
1194604239_1194604246 6 Left 1194604239 X:95960866-95960888 CCTACCACCAGGTAGCTGGCTGA No data
Right 1194604246 X:95960895-95960917 CGAGGAACGTTGCCATATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194604246 Original CRISPR CGAGGAACGTTGCCATATTG AGG Intergenic
No off target data available for this crispr