ID: 1194604249

View in Genome Browser
Species Human (GRCh38)
Location X:95960907-95960929
Sequence CCATATTGAGGGCTCAGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 818
Summary {0: 55, 1: 133, 2: 202, 3: 173, 4: 255}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194604240_1194604249 14 Left 1194604240 X:95960870-95960892 CCACCAGGTAGCTGGCTGATCAC 0: 165
1: 218
2: 182
3: 147
4: 198
Right 1194604249 X:95960907-95960929 CCATATTGAGGGCTCAGTGTTGG 0: 55
1: 133
2: 202
3: 173
4: 255
1194604241_1194604249 11 Left 1194604241 X:95960873-95960895 CCAGGTAGCTGGCTGATCACCCC 0: 88
1: 205
2: 207
3: 161
4: 246
Right 1194604249 X:95960907-95960929 CCATATTGAGGGCTCAGTGTTGG 0: 55
1: 133
2: 202
3: 173
4: 255
1194604245_1194604249 -10 Left 1194604245 X:95960894-95960916 CCGAGGAACGTTGCCATATTGAG No data
Right 1194604249 X:95960907-95960929 CCATATTGAGGGCTCAGTGTTGG 0: 55
1: 133
2: 202
3: 173
4: 255
1194604244_1194604249 -9 Left 1194604244 X:95960893-95960915 CCCGAGGAACGTTGCCATATTGA No data
Right 1194604249 X:95960907-95960929 CCATATTGAGGGCTCAGTGTTGG 0: 55
1: 133
2: 202
3: 173
4: 255
1194604239_1194604249 18 Left 1194604239 X:95960866-95960888 CCTACCACCAGGTAGCTGGCTGA No data
Right 1194604249 X:95960907-95960929 CCATATTGAGGGCTCAGTGTTGG 0: 55
1: 133
2: 202
3: 173
4: 255
1194604243_1194604249 -8 Left 1194604243 X:95960892-95960914 CCCCGAGGAACGTTGCCATATTG No data
Right 1194604249 X:95960907-95960929 CCATATTGAGGGCTCAGTGTTGG 0: 55
1: 133
2: 202
3: 173
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194604249 Original CRISPR CCATATTGAGGGCTCAGTGT TGG Intergenic
901903781 1:12390701-12390723 CCATATCGAGGGCTCAGTGTTGG + Intronic
902666565 1:17943308-17943330 CCACATTGGGAGTTCAGTGTTGG + Intergenic
903929714 1:26855211-26855233 CCATATTCAGAGCTCAGAGGAGG - Exonic
903994168 1:27295160-27295182 CCAGAGTAAGTGCTCAGTGTTGG - Intronic
904179307 1:28654682-28654704 CCATATCAAGGGCTCAGTGTTGG + Intergenic
904336073 1:29798963-29798985 CCATATCAAGGGCTCAGCGTTGG - Intergenic
905028031 1:34864826-34864848 CTTTATTGAGTGGTCAGTGTGGG - Intergenic
905354209 1:37369757-37369779 CCATACCAAGGGCTCAGTGTTGG - Intergenic
905465366 1:38149078-38149100 CCATATCAAGGGCTCAGTGTTGG - Intergenic
906050623 1:42868384-42868406 CCATATCAAGGGCTCAGTGTTGG - Intergenic
906054806 1:42907176-42907198 CTATATCGGGGGCTCAGTGTTGG + Intergenic
906867888 1:49441997-49442019 CCATATCGTGGGCTCAGTGTTGG - Intronic
906872872 1:49503406-49503428 CCCCATTGAGGACTCTGTGTGGG - Intronic
907256121 1:53180486-53180508 CCATTTTGAGGGCTGAGGGTGGG - Intergenic
907780475 1:57561810-57561832 CCATATCGAGGGCTCAGTGTTGG - Intronic
908737524 1:67291788-67291810 CCATATCAAGGGCTCAGTGTTGG - Intergenic
909032752 1:70561321-70561343 CCACATTGAGGGCTCAGTGTTGG + Intergenic
909548817 1:76876223-76876245 CCATATCGAGGGCTCAGTGTTGG + Intronic
909577064 1:77186828-77186850 CCATATTGAGGGGTCAGTGTTGG - Intronic
909858782 1:80576071-80576093 CCATATCAAGAGATCAGTGTTGG + Intergenic
910320471 1:85937856-85937878 ACTAATTGAGGCCTCAGTGTGGG - Intronic
910370773 1:86513106-86513128 CCATATGGAGGGCTCAGTGTGGG - Intergenic
910562030 1:88600944-88600966 CCATATCGAAGGCTTAGTGTTGG - Intergenic
910588351 1:88902695-88902717 CCATATCAAGGGCTCAGTGTTGG - Intergenic
910630351 1:89347239-89347261 CCATATCGAGGGCTCAGTGTTGG - Intergenic
910830963 1:91462446-91462468 CCATATCGAGGGCTCAGTGTTGG + Intergenic
910948347 1:92617683-92617705 CCATATCAAGGGCTCAGTGTTGG - Intronic
911257204 1:95646387-95646409 CCATATTGAGGGCTCAATGTTGG + Intergenic
911275018 1:95850022-95850044 CCCTAGTGAGGACTCTGTGTGGG - Intergenic
911497993 1:98654011-98654033 CCATATTGAGGGCTCAGTGTTGG + Intergenic
911738263 1:101360956-101360978 CCATGTTGAGGGCTCAGTGTTGG + Intergenic
911883704 1:103271437-103271459 CCATATCAAGGGCTCAGTGTTGG - Intergenic
911980551 1:104560398-104560420 TCATATCGAGGGCTCAGTGTTGG - Intergenic
912050567 1:105523975-105523997 CCGTATTGAGTGCTTAGTGTTGG + Intergenic
912067149 1:105757927-105757949 CCATATTGAGGGCTCAGTGTTGG - Intergenic
912129777 1:106587082-106587104 CCATATCGAGGGCTCAGGGTTGG + Intergenic
912212384 1:107569831-107569853 CCATATCGAGGGCTCAGTGTTGG - Intergenic
912251888 1:108020410-108020432 CCATATTGAGGGTTCAGTGTTGG + Intergenic
912733191 1:112127858-112127880 CCATATCAAGGGCTCAGTGTTGG + Intergenic
912943671 1:114067231-114067253 CCATATTGAGGGCTCAGCATTGG + Intergenic
913039308 1:115007423-115007445 TCATATCAAGGGCTCAGTGTTGG + Intergenic
913638567 1:120788985-120789007 CCATATCAAAGGCGCAGTGTTGG + Intergenic
914279891 1:146161000-146161022 CCATATCAAAGGCGCAGTGTTGG - Intronic
914540929 1:148611918-148611940 CCATATCAAAGGCGCAGTGTTGG - Intronic
914625711 1:149459328-149459350 CCATATCAAAGGCGCAGTGTTGG + Intergenic
914965380 1:152252930-152252952 CCATATCGAGGGCACAGTGTTGG + Intergenic
915667542 1:157458698-157458720 CCATATGGAGGGCTCCGTGTTGG + Intergenic
915709793 1:157884617-157884639 CCATATTGAAGGGTCAGTGTTGG - Intronic
916017237 1:160761031-160761053 CCATATTGGGGTCCTAGTGTTGG + Intergenic
916106061 1:161433323-161433345 CCATATTGAGGACTCAGTGTTGG + Intergenic
916285463 1:163100494-163100516 CCATATCAAGGGCTCAGTGTTGG - Intergenic
916461291 1:165027591-165027613 CCATATAGAGGGCTCAGCATGGG - Intergenic
916832705 1:168509460-168509482 CCAGAGTAAGGGGTCAGTGTGGG - Intergenic
917217083 1:172689932-172689954 CCATATTGAGGGCTCAGTGTTGG + Intergenic
917462838 1:175247132-175247154 CCATATGGAGGGCTCAGTGTTGG - Intergenic
917764673 1:178202986-178203008 CCATTTTGAGGGCTCAGTTTTGG - Intronic
918038288 1:180896493-180896515 CCATATTGGGGACTCAGTGTTGG - Intergenic
918755577 1:188336838-188336860 CCATATTGAGGGCTCAGTGTTGG + Intergenic
918774634 1:188611722-188611744 CCATATTGAGTCCTCAATGTTGG - Intergenic
918783340 1:188731592-188731614 TCATATGGAGGGCACAGTGTTGG + Intergenic
918815190 1:189172197-189172219 ACATATGGAGGGCACAGTGCTGG - Intergenic
918918102 1:190670910-190670932 CCATATCGAGGGCTCAGTGTTGG + Intergenic
918958368 1:191238908-191238930 CCGTATCGAGGGCTCAGTGTTGG - Intergenic
919124242 1:193376992-193377014 CTATATCGAGGGCTCAGTGTTGG + Intergenic
919241899 1:194925180-194925202 CCATATCAAGGGCTCAGTGTTGG - Intergenic
919330338 1:196162902-196162924 CCACATCAAGGGCTCAATGTTGG - Intergenic
920197569 1:204239331-204239353 CCATATCAAGGGCTCAATGTTGG - Intronic
921697795 1:218232023-218232045 CCTTCTTGAGGACTCATTGTGGG + Intergenic
921986455 1:221317872-221317894 CCATACAGAGGGCTCAGTGTTGG - Intergenic
922780916 1:228251627-228251649 CCATATCGAGGGCTCATTGTTGG + Intronic
923426585 1:233876179-233876201 CCATATTGGGAATTCAGTGTTGG - Intergenic
924096935 1:240561901-240561923 TCAAATTGAGGGTTCAGCGTTGG + Intronic
924182401 1:241452265-241452287 CCATATTGGAGGCTCAGTGTTGG + Intergenic
924840638 1:247706855-247706877 CCATATCGAGGTCTCAGTGATGG + Intergenic
924847007 1:247784169-247784191 CCATATCAAGGGCTCAGTGTTGG + Intergenic
1063788256 10:9409480-9409502 CCATATTGAGGGCTCAGTGTTGG - Intergenic
1065607139 10:27429461-27429483 CCATATCAGGGACTCAGTGTTGG - Intergenic
1066166890 10:32798253-32798275 CCATATAGAGGGCTCAGTGTTGG + Intronic
1066245607 10:33580737-33580759 CCATGGTAAGGGCTCAGTGCTGG + Intergenic
1067026126 10:42845683-42845705 TCATACTGGGGACTCAGTGTTGG + Intergenic
1067125418 10:43511571-43511593 CCATATCAAGGGCTCAGTGTTGG + Intergenic
1067754216 10:48992743-48992765 CCATATAGAGGGCTCAATGTTGG + Intergenic
1068007536 10:51408605-51408627 CCATATCGAGTGCTCAGTGTTGG + Intronic
1068447332 10:57139569-57139591 CCATATTGGGGGCTCAGTGTTGG - Intergenic
1068837080 10:61567405-61567427 CCATATCAAGGGCTCAATGTCGG + Intergenic
1068909026 10:62358599-62358621 CTATATTGAAGACTCAGTATTGG - Intergenic
1069145888 10:64891401-64891423 CCATATCCAGGACTCAGTGTTGG - Intergenic
1069192173 10:65505395-65505417 CCATATTGAAGGTTCAGTGCTGG + Intergenic
1069209796 10:65741884-65741906 CCATATCGGAGTCTCAGTGTTGG + Intergenic
1069790698 10:71018609-71018631 CCATATAGAGGGTTCAGTGTTGG + Intergenic
1071032873 10:81205690-81205712 CAATATTTAGGGCTCAGTATTGG - Intergenic
1071308647 10:84323027-84323049 CCACATCAAGTGCTCAGTGTTGG - Intergenic
1071364349 10:84883548-84883570 CCATATCGAGGGCTCAGTGTTGG + Intergenic
1071378517 10:85034334-85034356 CTATATCCAGGGCTCAATGTTGG - Intergenic
1071609818 10:87022192-87022214 CCAGGGTGAGGGCTCAGTGCTGG - Intronic
1071673781 10:87636451-87636473 CCGTACTGAGGGCTCAGTGTTGG + Intergenic
1071937826 10:90550252-90550274 CCATATCAAGAGCTCAGTGTTGG - Intergenic
1071942648 10:90606800-90606822 CCATATTGAGGGCTCATTGTTGG + Intergenic
1071950697 10:90700101-90700123 CCATATAGGGGGCTCAGTGTTGG + Intergenic
1072209131 10:93230732-93230754 CCATATCGAGGGCTCATTGTTGG + Intergenic
1072360593 10:94655061-94655083 CCATATCAAGGGCTCAGTGTTGG - Intergenic
1072637902 10:97189060-97189082 CCAGAATGAGGGCACAGAGTGGG + Intronic
1073557487 10:104466868-104466890 CCATATCGAGGGCTCAGTGTTGG - Intergenic
1073656544 10:105423517-105423539 CCATATTGAGGGCTCAGTGTTGG + Intergenic
1073918360 10:108431480-108431502 TCATATCGAGGGCTCAGTGTCGG + Intergenic
1073979896 10:109142674-109142696 CCATAGTGGGGACTCTGTGTGGG - Intergenic
1074100314 10:110349447-110349469 GCTTGCTGAGGGCTCAGTGTTGG + Intergenic
1074632394 10:115273095-115273117 CCATATCAGGAGCTCAGTGTTGG + Intronic
1074657989 10:115616940-115616962 CCCCAGTGAGGGCTCTGTGTAGG - Intronic
1075606927 10:123818380-123818402 CCATATTGAGGGCTTAGTGTTGG - Intronic
1076271452 10:129155798-129155820 CCATACCAGGGGCTCAGTGTTGG - Intergenic
1076772484 10:132673863-132673885 CCATATCAAGGACTCAGTGTTGG + Intronic
1076927269 10:133498241-133498263 CCATATCGAGGAATCAGTGTTGG + Intergenic
1079373405 11:19871254-19871276 CCATATTTATGACTCAGTGACGG + Intronic
1080020032 11:27550707-27550729 CCATACTGGAGGCTCTGTGTTGG + Intergenic
1080561154 11:33464347-33464369 CTATCTTAGGGGCTCAGTGTAGG - Intergenic
1081065336 11:38533943-38533965 CCATATCCAGGGCTCTGTGTTGG + Intergenic
1081110659 11:39129686-39129708 CCATATCGAGGGCTAAGTGTTGG - Intergenic
1081200691 11:40211626-40211648 TTATATTTGGGGCTCAGTGTAGG - Intronic
1081246317 11:40771040-40771062 CCTTAGTGGGGACTCAGTGTGGG + Intronic
1081378420 11:42386878-42386900 CCATATCGAAGGTTCAGTGTTGG - Intergenic
1081520344 11:43875445-43875467 ACATATGGAGGGCTCAGTATTGG + Intergenic
1081576656 11:44322908-44322930 CCAGAGTGGGGGCTCAGGGTGGG + Intergenic
1081609197 11:44548833-44548855 CCATATCGAGGGCTCAGTGTTGG - Intergenic
1081820660 11:45990869-45990891 CAGTATTGAGGTGTCAGTGTAGG - Intronic
1082671823 11:56043983-56044005 CCATATTGAGGGCTCAGTGTTGG - Intergenic
1082999793 11:59280814-59280836 CCATATCGAGAGCTCCGTGTTGG - Intergenic
1083093269 11:60222071-60222093 CTATATTGAGGGCTCAGTGCTGG - Intronic
1084606413 11:70174956-70174978 CCTTTGTGAGGACTCAGTGTGGG - Intronic
1085616094 11:78000057-78000079 CCATATCAGGGGCTTAGTGTTGG + Intergenic
1085684799 11:78611817-78611839 CCATATCTGGGGTTCAGTGTTGG - Intergenic
1085686091 11:78623137-78623159 CCACATCGAGGGCTCAGTGTTGG - Intergenic
1086141496 11:83505252-83505274 CCATATTGAGGGCTCAGTGTTGG + Intronic
1086278739 11:85161403-85161425 CCATATCGAGGGCTCGGTGTTGG - Intronic
1087347729 11:96992439-96992461 CCATATTGGGGAATCAGTGCTGG - Intergenic
1087374147 11:97321495-97321517 CCATATTGAGGGCTTAGTGTTGG - Intergenic
1087984335 11:104658793-104658815 CCATATTGAGGGCCCAGTGTCGG - Intergenic
1088191519 11:107233547-107233569 CCATACCGAAGGCTCAGTATTGG + Intergenic
1088265555 11:107984551-107984573 CCATATCGAGGGCTCAGTGTTGG - Intergenic
1088449480 11:109966303-109966325 CCATATCAAGAGCTCAGTGTTGG - Intergenic
1088742230 11:112776592-112776614 CCATACTGGGGACTCAGTGTTGG + Intergenic
1088836791 11:113584331-113584353 CCATATCGAGGGCTCAGTGTTGG - Intergenic
1089903748 11:122014562-122014584 CCATATTGAGGTCTCTGTGTTGG - Intergenic
1090119061 11:124005444-124005466 CCATATTGAGGGCTCATGGTTGG + Intergenic
1090262846 11:125334001-125334023 CCAGAGTCAGGGCTCAGTGGAGG + Intronic
1091051879 11:132379705-132379727 CCATATCGAGGACTTAGTGTTGG - Intergenic
1092093416 12:5822585-5822607 CCATATTTAGGGCTCAGTGTTGG - Intronic
1092381681 12:8001874-8001896 CCATATCAAGGGCTCAGTGTTGG - Intergenic
1093031730 12:14294984-14295006 CCATATCAAGGGCTCAGTGTTGG + Intergenic
1093036480 12:14336627-14336649 CCATATCGAGGGCTAAGTTTTGG - Intergenic
1093048805 12:14484125-14484147 CTGTATCGAGGGCTCAGTGTTGG + Intronic
1093049540 12:14490023-14490045 CCCGAGCGAGGGCTCAGTGTTGG + Intronic
1093645846 12:21584609-21584631 CCATATCAAGGGCTTAGTGTTGG - Intronic
1093964673 12:25311902-25311924 CTATATTGAGGGCTCAGTGTTGG - Intergenic
1093981474 12:25479847-25479869 CCATATCAAGGGCTCAATGTTGG + Intronic
1094102664 12:26780213-26780235 CCATATCGAAGGCTCAGTGTTGG - Intronic
1094389658 12:29935272-29935294 CCATATCGGGGACTCAGTGTTGG + Intergenic
1094733644 12:33207662-33207684 CCATATTGATGGCATAGAGTTGG + Intergenic
1095121379 12:38423888-38423910 CCATATCAAGGGCTCAGTGTTGG + Intergenic
1095603985 12:44045286-44045308 CCATATCAAGGGCTCAGTGTTGG - Intronic
1095844254 12:46729024-46729046 CCATATTGAGGGCTCAGTGTTGG + Intergenic
1095856120 12:46862725-46862747 CCATATCAAGGGCTCAGTGTTGG + Intergenic
1096288908 12:50324201-50324223 TCATATCGAGGGCTCAGTGTTGG - Intergenic
1096457326 12:51798497-51798519 TCATATTGAGGGCTCAGTGTTGG + Intronic
1096735103 12:53647077-53647099 CCATAGTGGGGACTTAGTGTTGG - Intronic
1097077128 12:56403350-56403372 TCATATCAAGGGCTCAGTGTTGG - Intergenic
1097207419 12:57334727-57334749 ATATATTGAGGAATCAGTGTAGG + Intronic
1097437700 12:59571313-59571335 CCATATCAAGGGTTCAGTGTTGG + Intergenic
1097554721 12:61122553-61122575 CCATATCGAGGGCTCAGTGTTGG - Intergenic
1097564515 12:61251498-61251520 CCATATCAAGGGCTCAGTGTTGG + Intergenic
1097843217 12:64341801-64341823 CCATATTGAGGGCTCAGTGTTGG + Intronic
1098673151 12:73255195-73255217 CCATATCAAGGGCTCAGTGTTGG - Intergenic
1098733421 12:74066576-74066598 TCATATCAAAGGCTCAGTGTTGG - Intergenic
1098749968 12:74280547-74280569 CCATATCAAGGACTCAGTGTTGG - Intergenic
1098831779 12:75373081-75373103 CCATATCGAGGGTTCAGTGTTGG + Intronic
1099183253 12:79491654-79491676 TCATATCAAGGGCTCAGTGTTGG + Intergenic
1099375779 12:81894900-81894922 CCATATGGAGGGCTCAGTGTTGG - Intergenic
1099401078 12:82204418-82204440 CCATATCAAGGGCTCAATGATGG + Intergenic
1099490543 12:83283301-83283323 CCATATCAGGGGCTCAGTGTTGG + Intergenic
1099508702 12:83508135-83508157 CCATATCGAGGGCTCAGTGTTGG - Intergenic
1099578195 12:84406349-84406371 CCATATGAAGGGCTCAGTGTTGG - Intergenic
1099669685 12:85674191-85674213 CCTTAGTGAGAGCTCTGTGTGGG + Intergenic
1099689908 12:85938972-85938994 CCATATGGAGGGCTCAGTGTTGG - Intergenic
1099700753 12:86078599-86078621 CTATATCGAAGGCTCAGTGTTGG + Intronic
1100032404 12:90209261-90209283 CCCCATTGAGGACTCTGTGTGGG - Intergenic
1100083436 12:90879157-90879179 CCATATCGAGGGGTCAGTGTTGG - Intergenic
1100232088 12:92618859-92618881 CCATGTTGGGAGCTCAGTGTTGG - Intergenic
1101534479 12:105604805-105604827 CCATATCGAGGGCTCAGTGTTGG + Intergenic
1101543199 12:105683585-105683607 CCATATTGAGGGCTCAGTGTTGG - Intergenic
1102135166 12:110568146-110568168 CCAGATTGAGGGCTCAGCAAAGG - Intronic
1102245528 12:111353454-111353476 ACATATTGTGTGCTCAGAGTTGG + Intergenic
1102439329 12:112949237-112949259 CCCTATCGAGGGATCAGCGTGGG + Intronic
1102587420 12:113933064-113933086 CCAGATAAAGGGCTCAGAGTGGG - Intronic
1103035758 12:117655023-117655045 ACATATCGAGGGCTCAGTGTTGG - Intronic
1103396666 12:120612398-120612420 CCATATCGAGGGCTCAGTATTGG - Intergenic
1104147927 12:126053613-126053635 CCATATCAAGGGCTCAGTGTGGG - Intergenic
1105384137 13:19914487-19914509 CCATATCAGGGACTCAGTGTTGG - Intergenic
1105740248 13:23316132-23316154 CCATATCAAGGGCTCAGTGTTGG - Intronic
1105852628 13:24349355-24349377 CCATATCAAGGGCTGTGTGTTGG + Intergenic
1107430499 13:40336089-40336111 TCATCCTGAGGGCTGAGTGTCGG + Intergenic
1107505290 13:41027522-41027544 CCATACTGGGGGCTCATTGCTGG - Intronic
1107983449 13:45755020-45755042 CCATATCGAGGGCTCAGTGTTGG + Intergenic
1108914178 13:55587937-55587959 CCACATCGAGGGCTCAGTGTTGG + Intergenic
1109519159 13:63485752-63485774 CCATATCGAGGAATCAGTGTTGG - Intergenic
1109712553 13:66179883-66179905 CCATATTGAGGACTCAGTGTTGG + Intergenic
1109931747 13:69225369-69225391 CCATATGAAGGGCTCAGTGTTGG - Intergenic
1109950889 13:69501260-69501282 CTATATCGAGGGCTCAGTGTTGG + Intergenic
1110377296 13:74807462-74807484 CTATATCGAGGGCTCAGTGTTGG - Intergenic
1110812828 13:79829386-79829408 CCATATTGGGGTCTCAGTGTTGG - Intergenic
1110815561 13:79856825-79856847 TTATATTGAAGGCTCAGTGTTGG - Intergenic
1110834006 13:80063679-80063701 CCATATCAAGGTCCCAGTGTTGG + Intergenic
1111016327 13:82386936-82386958 CCATATTGAGGGCTCAGTGTTGG + Intergenic
1111044496 13:82796864-82796886 TCCTCTTGGGGGCTCAGTGTTGG - Intergenic
1111198665 13:84905837-84905859 TCATACTGAGGGCTCAGTGTTGG - Intergenic
1111317633 13:86582750-86582772 CCATATCAAGGGCTCAGTGTTGG - Intergenic
1111535325 13:89596122-89596144 ACATATTGAGGGCTCAGCGTTGG - Intergenic
1111536170 13:89605661-89605683 CCATATCAAGGGCTCAGTATTGG + Intergenic
1114126413 14:19731263-19731285 CCATATTGAGGGCTTAGCATTGG + Intronic
1114205996 14:20571718-20571740 CCATATCGAGGGCTCAGTGTTGG - Intergenic
1114658589 14:24330803-24330825 CGATATTGAGGGATCTCTGTAGG + Intronic
1114758119 14:25282929-25282951 CCATATCAAAGGCTCAGTGTTGG + Intergenic
1114905263 14:27119609-27119631 CCATATCGAGGGCTCAGTGTTGG + Intergenic
1115059838 14:29174833-29174855 CTATAATGAGGGCTCAGTGTTGG - Intergenic
1115829955 14:37326572-37326594 CCATGTTGGGAGCTCAGTGCTGG + Intronic
1116098878 14:40408271-40408293 CCCCAGTGAGGGCTCTGTGTGGG + Intergenic
1116218647 14:42053476-42053498 TCATATTGAGGGCTTAGTGTTGG - Intergenic
1116249179 14:42458585-42458607 CTGTATTGAGGTCTCAGTGTTGG - Intergenic
1116307936 14:43282509-43282531 CCATATCTATGTCTCAGTGTTGG + Intergenic
1116415197 14:44670245-44670267 CCATATTGAGGCCTCAGTGTTGG - Intergenic
1116443395 14:44980418-44980440 CCACTTTGAGAGGTCAGTGTGGG + Intronic
1117216983 14:53561125-53561147 CCATATCAAGGGCTCAGTGTTGG - Intergenic
1117634270 14:57725326-57725348 CCATATCGAGGGCTCAGTGTTGG - Intronic
1117656532 14:57961736-57961758 CCAGATGGAGGGAGCAGTGTGGG - Intronic
1117779993 14:59222457-59222479 CCATAAAGGGGGCTCAGTGTTGG + Intronic
1118083375 14:62387552-62387574 CCCTAGTGAGGACTCTGTGTGGG - Intergenic
1118122306 14:62859228-62859250 CCATATCGAGGGCTCGGTGTTGG + Intronic
1118501957 14:66370334-66370356 CCATGTTGGGGGCTCCATGTTGG - Intergenic
1118880641 14:69823065-69823087 GGTTATTGAGGGTTCAGTGTTGG + Intergenic
1118950620 14:70433623-70433645 CCATATTGAGGGCTCAGTGTTGG + Intergenic
1119059571 14:71461245-71461267 CCATATCAAGGACTCAGTGTTGG + Intronic
1119107425 14:71937892-71937914 CCATATGGAGGGGTCAGTGTTGG + Intronic
1120231310 14:81844302-81844324 CCATATTGAGGGCTCAATGTTGG + Intergenic
1120498276 14:85262633-85262655 CCATATCGAGGGCTCAGTGTTGG + Intergenic
1120844386 14:89113092-89113114 CCATGGTGAGGGTTCAGTGGCGG - Intergenic
1120973833 14:90231748-90231770 CCATATTGAGGGCTCAGTGTTGG - Intergenic
1122324601 14:100874891-100874913 CCCTTTGGAGGGCTCTGTGTGGG - Intergenic
1122841315 14:104465106-104465128 CCATATCAAGGGCTTGGTGTTGG + Intergenic
1123569926 15:21593482-21593504 CCATATTGAGGGCTTAACATTGG + Intergenic
1123606038 15:22028801-22028823 CCATATTGAGGGCTTAACATTGG + Intergenic
1123908372 15:24942755-24942777 CCATAGTGGAGACTCAGTGTTGG + Intronic
1124571314 15:30866750-30866772 CCATATTAAGGACTCAGTGTTGG + Intergenic
1124571807 15:30871265-30871287 CCATATCAGGGACTCAGTGTTGG - Intergenic
1126283732 15:46987205-46987227 CCATATTGAGGGCTCAGTGTTGG - Intergenic
1127067498 15:55255965-55255987 CCATATTGAGGAAACAGTGTGGG - Intronic
1127643479 15:60937039-60937061 CCATATGGAGTGCTCTATGTTGG + Intronic
1130131985 15:81151359-81151381 CCATATCAAGGGCTCAGTGTTGG + Intergenic
1130377049 15:83338515-83338537 CCATATCAAGGAGTCAGTGTTGG - Intergenic
1131326137 15:91447966-91447988 TCATATTGAGGTCTCAGCATTGG + Intergenic
1131592422 15:93763965-93763987 CCATCTTGAGGCCTCAGGCTGGG + Intergenic
1131724147 15:95203750-95203772 CCATATGGAGGGATCAGTGTTGG - Intergenic
1131836700 15:96398108-96398130 GCATAGTGAGTGCTCAGTCTAGG - Intergenic
1202978276 15_KI270727v1_random:320574-320596 CCATATTGAGGGCTTAACATTGG + Intergenic
1135061501 16:19275015-19275037 CCATATTGGGTGCTCAGTGCTGG + Intergenic
1138868509 16:60851734-60851756 CCATATTGAGGTCTCAGTGTTGG - Intergenic
1138877280 16:60967252-60967274 ACATATTGTGGGCTCAGTGTAGG - Intergenic
1139309979 16:66020124-66020146 CCATAATGATGGCTCAGTTGTGG + Intergenic
1141559410 16:84857088-84857110 CCATATCGAGGGCTCAGTGTTGG + Intronic
1142404804 16:89882189-89882211 CCATATTGTGTGTTCAGTGGTGG + Intronic
1143101548 17:4507217-4507239 CCATGTGGAGGCCTCAGTGCTGG - Intronic
1144327152 17:14193384-14193406 CCATGGTGAGGGCTCAATTTGGG + Intronic
1144391193 17:14795105-14795127 CCATGGTGAGGGCTCTGTGTGGG + Intergenic
1144476040 17:15590247-15590269 CCATGGTGAGGGCTCAATTTGGG + Intronic
1146238115 17:31186897-31186919 TCATATCAAGGGCTCAGTGTTGG - Intronic
1146758566 17:35455082-35455104 CCATATTGAGTGCTCAGTGTTGG - Intergenic
1146836489 17:36114925-36114947 CCATATCGAGGGCTCAGTGTTGG - Intergenic
1146851067 17:36221984-36222006 TCATATTGAGGGCTCAATATTGG - Intronic
1150535619 17:66036510-66036532 CTATAATGAGGGTTCAGTGGTGG - Intronic
1151037668 17:70820648-70820670 CCATATCGAGGGCTCAGTGTTGG + Intergenic
1151336476 17:73442928-73442950 TCATCTTGATGGGTCAGTGTAGG + Intronic
1153131143 18:1856775-1856797 CCATATTGAAGGCTCAACATTGG + Intergenic
1153217555 18:2834655-2834677 CCATATTGAGGGCTCAGTGTTGG + Intergenic
1153736652 18:8077683-8077705 CCATTTTTAGGTCTCAGTTTTGG + Intronic
1154068601 18:11132030-11132052 ACATATCGAGGGCTCAGTATTGG - Intronic
1154252428 18:12755737-12755759 CCATGTCGAGGGCTTAGTATTGG + Intergenic
1154273174 18:12937345-12937367 CCATATTGGAGCCTCAGTGTTGG + Intergenic
1155234194 18:23803278-23803300 CCATATTGAGGACTTGGTATTGG + Intronic
1156118570 18:33816671-33816693 TCATATTGGGGACTCAGTGTTGG - Intergenic
1156303987 18:35859642-35859664 CCATAATGAGGGCTCAGTGTTGG - Intergenic
1156814561 18:41294227-41294249 CCACCTTGAGTGCACAGTGTAGG + Intergenic
1156998704 18:43498676-43498698 CCATATCAAGGGCTCATTGTTGG - Intergenic
1157341339 18:46780959-46780981 CCATATCAAGGGCTCAGTGTTGG - Intergenic
1157870808 18:51228648-51228670 CCATATCGAGGGCTCAGTATTGG + Intergenic
1157900238 18:51507981-51508003 CCATATTGGGGGCACAGTGTTGG + Intergenic
1157955202 18:52089264-52089286 CCATATTAAGGGCTTAGTGTTGG - Intergenic
1157998368 18:52587177-52587199 CTATATCGCGGGCTCAGTGTTGG + Intronic
1158125801 18:54098766-54098788 CCCTGTCGAGGCCTCAGTGTGGG + Intergenic
1160092577 18:75840961-75840983 CCATATGAAGGGCTTAGTGTTGG - Intergenic
1160568994 18:79803854-79803876 CCATGCTGAGGCCTCCGTGTTGG + Intergenic
1160599430 18:80001388-80001410 CCCTAGTGAGGACTCTGTGTGGG - Intronic
1166396366 19:42444129-42444151 CCAAGTTGAAGGCTCAGGGTGGG + Intergenic
1166844578 19:45718768-45718790 CCTTATGCTGGGCTCAGTGTGGG - Intronic
1167951757 19:53033188-53033210 CCATATTGAGGGCTCAGTGTTGG - Intergenic
1168539199 19:57196458-57196480 CCATATTGAGGGCTCAGTGTTGG + Intronic
925105425 2:1286748-1286770 CCATATTGAGGGCTCAGTGTTGG + Intronic
925280088 2:2677809-2677831 CCATATTTAGGGCTCAGTGCTGG - Intergenic
925460856 2:4061391-4061413 TCATATCGAGGGCTCATTGTTGG - Intergenic
925499274 2:4485983-4486005 CCATATTGAGGGCTCAGTACTGG + Intergenic
927259000 2:21067954-21067976 CAATATTGAAGGCTCTGTCTGGG - Intergenic
928774217 2:34739005-34739027 TCATATCAAGGGGTCAGTGTTGG + Intergenic
928866213 2:35920172-35920194 TCATGTTGAGGGATCACTGTTGG + Intergenic
930132676 2:47868771-47868793 CTATATTGGGGGCTAAGTATTGG - Intronic
930295077 2:49544427-49544449 CCATATCGAGGGCTCAGTGTTGG + Intergenic
930318727 2:49828059-49828081 ACATTTTGAGGGCTCAGAGTGGG + Intergenic
930418720 2:51121925-51121947 TCACATTGAGAACTCAGTGTTGG - Intergenic
930910265 2:56621812-56621834 CCATATGAAGGTCTCAGTGTTGG - Intergenic
932610816 2:73198451-73198473 TCATATTGGGGGCTCAGTGTTGG - Intergenic
932756481 2:74413395-74413417 CCATAGTGAGGATTCAGGGTGGG + Intergenic
932870564 2:75394137-75394159 CCATATCAAGGGCTCAGTGTTGG + Intergenic
932975801 2:76598147-76598169 CCATATCGAAGGCTCATTGTTGG - Intergenic
933265559 2:80177427-80177449 CCATATTGAGGGCTCAGTGTTGG + Intronic
933394338 2:81712410-81712432 CCATATCAAGGGCTCAGTGTTGG + Intergenic
933504652 2:83161821-83161843 CTATATTGAAGGCTCAGTCTTGG + Intergenic
935184078 2:100715845-100715867 CCATATCAAGGGCTCAGTGTTGG - Intergenic
935546701 2:104406992-104407014 CCAATTTGAGGGCTCACTTTAGG - Intergenic
935564171 2:104589309-104589331 CCATACCGAGGGATCAGTGTTGG + Intergenic
936641354 2:114315638-114315660 TCATATTGAGGGCTCAGTGTTGG - Intergenic
937498368 2:122450044-122450066 CCATTTTGAGAGCTTAGTGGTGG + Intergenic
937581936 2:123498201-123498223 CCATATTAAGGGCTCAGTGTTGG + Intergenic
937582242 2:123500884-123500906 CCATATCAAGGGCTCAGTGCTGG - Intergenic
937765766 2:125658932-125658954 CCATATTGAGGGCTCAGTTTTGG - Intergenic
937841094 2:126525371-126525393 CCACATTGGAGGCTTAGTGTTGG + Intergenic
938709694 2:133965535-133965557 CCATATCAAGTGCTCAGTGTTGG - Intergenic
939023540 2:136985675-136985697 CCCTGTTGAGGACTCTGTGTGGG - Intronic
939069214 2:137518834-137518856 CCATATCGAAGGCTCAGTGTTGG - Intronic
939214000 2:139213185-139213207 CCATATTGAGGTCTCAGTGTTGG - Intergenic
939788549 2:146545169-146545191 CCATATTGAGGGCTCAGTGCTGG + Intergenic
939806367 2:146779417-146779439 CCATATCTAGGGCTCAGTGTTGG - Intergenic
940171176 2:150831762-150831784 CCATATCAAGGTCTCAGTGTTGG + Intergenic
940471964 2:154112172-154112194 CCATATGGAAATCTCAGTGTTGG + Intronic
941330531 2:164173616-164173638 CCATATAGAGGGTTCACTGTTGG + Intergenic
942790820 2:179758386-179758408 CCAAGTTGAGGACACAGTGTTGG - Intronic
943182223 2:184559571-184559593 CCACATCGAGAACTCAGTGTTGG - Intergenic
943383939 2:187180145-187180167 CCATATCGAGGGCTCGGTGTTGG + Intergenic
943385763 2:187202291-187202313 CCATATCGAGGGCTCAGTGCTGG + Intergenic
943480475 2:188411324-188411346 CCATATCGAAGGCTTAGTGTTGG + Intronic
943517463 2:188906308-188906330 CCATATTGAGGGCTCAGTCTTGG + Intergenic
943663444 2:190583982-190584004 CCCTATTGAGGACTGAGAGTGGG + Intergenic
943799997 2:192045725-192045747 CCATATTAGGGACTCGGTGTTGG - Intronic
943833484 2:192490209-192490231 CCATATCAAGGGCTCAGTGTTGG + Intergenic
943936111 2:193918992-193919014 TCCCATTGAGGGCTCTGTGTGGG - Intergenic
945364161 2:208930194-208930216 CCATATTGAAGGCTTAGCGTTGG - Intergenic
945544987 2:211139057-211139079 CCATATCGAGGGCTCAGTGTTGG - Intergenic
945717706 2:213379722-213379744 CCATATTGAGGGCTCAGTGTTGG + Intronic
945725716 2:213470554-213470576 CCATATTGTGGGCTCAGTGTTGG + Intronic
946703624 2:222436850-222436872 CCATATCGAGGGCTCAGTGTTGG + Intronic
946791040 2:223300700-223300722 CCATATCTAAGGTTCAGTGTTGG - Intergenic
946873417 2:224105515-224105537 CCTTATTGAGGGCTCAGTGTTGG + Intergenic
947450322 2:230202534-230202556 CCATTTGAATGGCTCAGTGTGGG - Intronic
948232655 2:236363034-236363056 CCATATTGGAGGCTAGGTGTTGG - Intronic
948813699 2:240499148-240499170 GCATGCTGAGGGCTCGGTGTGGG + Intronic
948851490 2:240709900-240709922 CCATATTAAGGGCTCCCCGTCGG + Intergenic
1169610977 20:7379786-7379808 CCATATTGGGGGCTCATTGTTGG + Intergenic
1170279079 20:14625667-14625689 CCATATTGGAGGCTCAGTGTTGG - Intronic
1171315988 20:24195164-24195186 CCTTATTAGGGGCTCAGTGTTGG - Intergenic
1172324829 20:34026159-34026181 CAATAGTGAGGGCTGAGGGTTGG + Intronic
1173141790 20:40491141-40491163 CCATATTGAGGAATCAGAGTGGG + Intergenic
1173464193 20:43268242-43268264 CCATGGTCAAGGCTCAGTGTGGG + Intergenic
1174046104 20:47734994-47735016 CCATTTTGAGGGCTCAGGGTGGG - Intronic
1174656927 20:52179353-52179375 CCATCATGAGGGCTTAGTGATGG - Intronic
1176998300 21:15581215-15581237 CCATATTGAGGGCTCAGTGCTGG - Intergenic
1177139287 21:17341317-17341339 CCATATTGAGGGCTCAGTGTTGG + Intergenic
1177295407 21:19166947-19166969 ACATTTTGAGGTCTCAGTTTTGG - Intergenic
1177505431 21:22013257-22013279 CTATATCGAGGGCTCAGTGTTGG + Intergenic
1177521700 21:22235404-22235426 CCATATTGGGGGTTCAGTGCTGG - Intergenic
1177913309 21:27057157-27057179 CCATATCAAGGGCTCAGTGTTGG - Intergenic
1177937834 21:27371298-27371320 ACATACTGAGGGCTCAGTTGTGG + Intergenic
1178005911 21:28219485-28219507 TCATATCGAGGGCTCAGTGTTGG + Intergenic
1178012793 21:28306127-28306149 CCATATTGAGGGCTCAGTTTTGG - Intergenic
1178063182 21:28874434-28874456 TCATATCAGGGGCTCAGTGTTGG + Exonic
1179415010 21:41191589-41191611 CCATATTGAGGACTCGGTGTTGG + Intronic
1180591019 22:16937419-16937441 CCATACAAAGGGCTCAGTGTTGG + Intergenic
1181367260 22:22387583-22387605 CCACATCGAGGGCTCAGTGTTGG + Intergenic
1181373582 22:22438215-22438237 CCATATCAAGGGCTCAGTGTTGG + Intergenic
1182965840 22:34520246-34520268 TCATATTGGGGGCTCAGTGTTGG - Intergenic
1182980779 22:34668801-34668823 CCATATCCAGGGCTCAGAGTTGG + Intergenic
1184070362 22:42143118-42143140 CTATGCTGCGGGCTCAGTGTGGG - Intergenic
1184603430 22:45557418-45557440 CCACATCGAGGGCTCAGTGTTGG + Intronic
949125534 3:442164-442186 CCATATCGAGGGCTCAGTATTGG + Intergenic
949169905 3:985653-985675 CCATATCAAGGGCACAGTGTTGG + Intergenic
949246006 3:1925872-1925894 CCATATCAAGGGCTCAGTGTTGG - Intergenic
949292477 3:2482937-2482959 CCACAGTGGGGACTCAGTGTGGG - Intronic
949417447 3:3829941-3829963 CTTTATCGAGGGCTCAGTGTTGG + Intronic
949445745 3:4132006-4132028 CCATATCAAGGGCTCAGTGTTGG - Intronic
949639038 3:6014463-6014485 CCATATCAAGGGCTCAGTGTTGG - Intergenic
951003699 3:17593434-17593456 CCATATCGAGGGCTCAGTGTTGG - Intronic
951384647 3:22028466-22028488 CCATATTGAGGGCTCAGTGTTGG - Intronic
951970633 3:28440939-28440961 CCATATCGAAGACTCAGTGTTGG + Intronic
952205826 3:31181056-31181078 CCCTACTGAGGCCACAGTGTGGG + Intergenic
954054293 3:48008887-48008909 ACATACTGAGGGCTTGGTGTCGG - Intronic
954511350 3:51128718-51128740 CCATATCGAGGGCTCAGTGTTGG + Intronic
955340290 3:58120188-58120210 CCAAAGTGAGAGCTCACTGTTGG + Intronic
955801794 3:62694448-62694470 CCATATTAAGGACTCAGTGTTGG - Intronic
956306996 3:67836578-67836600 CCATATCAAAGGCTCTGTGTTGG - Intergenic
956509800 3:69981313-69981335 CCATATCGATGGCTCAGGGTTGG - Intergenic
956566114 3:70640258-70640280 CCATATAGGGGGCTCAGTGTTGG + Intergenic
956690829 3:71876374-71876396 CCATTTTCAGAGCACAGTGTTGG + Intergenic
956703770 3:71981954-71981976 CCATATCGAGGGCTCAGTGTTGG + Intergenic
957247441 3:77732952-77732974 CCATATCGAGGGCTCAGTGTTGG + Intergenic
957754721 3:84470374-84470396 TTATATTGAGGGCTCAGCATCGG - Intergenic
957875061 3:86133823-86133845 ACATACTGGGGACTCAGTGTTGG - Intergenic
958487547 3:94731526-94731548 TCATATCGAGGGTTCAGTGTTGG + Intergenic
958675486 3:97264579-97264601 CCATATTGTGGGCTAAGAGAAGG - Intronic
958745202 3:98125939-98125961 ACAGATTGAGGACTCAGTGTTGG + Intergenic
958845654 3:99261475-99261497 CTATATTGAGGGCTCAGAGTTGG + Intergenic
958934440 3:100241559-100241581 CCATATCGAGGGCTCAGTGTTGG - Intergenic
959226646 3:103596333-103596355 TCATATGGAGGGCTCAGTGTTGG + Intergenic
959377333 3:105602743-105602765 CCATATGGAGGGCTCAGTGATGG + Intergenic
959439640 3:106360131-106360153 CCATATCGAAGGCGCAGTGTTGG - Intergenic
959745883 3:109776328-109776350 CCATATTGAGGGCTCATTGTTGG + Intergenic
959998000 3:112699267-112699289 CCATATTGAGGGCTCAGTGTTGG - Intergenic
960349649 3:116576648-116576670 CTATATCGAGCCCTCAGTGTTGG - Intronic
960494609 3:118359809-118359831 CCATATAAAGGGCTCAGTGTTGG + Intergenic
960528394 3:118736322-118736344 CCATATTGAGAGCTCAGCTTTGG + Intergenic
960915269 3:122688599-122688621 CCATAGTCAGGGATCAGTGTGGG - Intronic
961262982 3:125617335-125617357 CCATATCAAGGGCTCGGTGTTGG - Intergenic
961710847 3:128827071-128827093 TCATATCGAGGGCTCAGTGATGG + Intergenic
962067025 3:131992107-131992129 CCCCACTGAGGACTCAGTGTAGG - Intronic
962214799 3:133512025-133512047 CCATATCAGAGGCTCAGTGTTGG - Intergenic
962784016 3:138749724-138749746 CAGCATTGATGGCTCAGTGTAGG + Intronic
962904834 3:139792148-139792170 CAATATTGAGGGCTTATTATTGG + Intergenic
963331676 3:143922426-143922448 CCATATCGAGGGCTCAGTGTTGG + Intergenic
963355531 3:144205920-144205942 CCATATCGTGGGCTCAGTGTTGG + Intergenic
963379112 3:144506336-144506358 CCATATGGAGGGCTTAGTGTTGG + Intergenic
963548650 3:146694031-146694053 CCATATTAAGGGCTCAGTGTTGG + Intergenic
963630440 3:147724168-147724190 CCATATCGAAGGCTCATTTTTGG - Intergenic
963661522 3:148133085-148133107 CCATATTGAGGGCTCAATGTTGG - Intergenic
963970183 3:151421006-151421028 GCATATCGTGGGCTCAGTGTTGG + Intronic
964505577 3:157395351-157395373 CCATATAGAGGGCTCATTGCTGG + Intronic
964639543 3:158893997-158894019 CCATATCTGGGGATCAGTGTTGG + Intergenic
964679103 3:159317966-159317988 CCATATCGAGGGTTCAGTGTTGG + Intronic
965099016 3:164273229-164273251 CCATACTAGGGACTCAGTGTTGG - Intergenic
965226632 3:165999823-165999845 CCATATGGAGTGCTCAGTATTGG + Intergenic
965254299 3:166384606-166384628 ACATATTGAGGGTTCAGTTGGGG + Intergenic
965259824 3:166467755-166467777 CCATATCAAAGGCTCAATGTTGG - Intergenic
965291618 3:166888644-166888666 CCATATCGAGGGCTCAATGTTGG + Intergenic
965708389 3:171532518-171532540 CCATATTGGAGAATCAGTGTTGG + Intergenic
966044200 3:175529972-175529994 CCATATCGAGGGCTCAGTGTTGG + Intronic
966445820 3:179999507-179999529 CCATATTGAGAGCTCAGTGTTGG - Intronic
967311852 3:188113678-188113700 CCAAATTAAGGCCTCAGGGTGGG + Intergenic
967447102 3:189579420-189579442 CCATATCAAGGGATCAGTGCAGG - Intergenic
967831924 3:193926928-193926950 TCATATCGAGGGCTCACTGTTGG - Intergenic
970524116 4:16914013-16914035 CCATATTGAGGACTCAGTGTTGG - Intergenic
970629418 4:17924450-17924472 CCATATTGAGGGCTCAGTGTTGG - Intronic
970644949 4:18109022-18109044 CCATATCGAGGGCTCAGTGTTGG + Intergenic
970766965 4:19561570-19561592 CCATATTGAGGGATTATTGCAGG - Intergenic
970941721 4:21641886-21641908 CCATATTGAGAACTCAGTGTTGG - Intronic
971100886 4:23465473-23465495 CCATATCGAGGGCTCACTGTTGG + Intergenic
971126564 4:23761255-23761277 CCATATCGAGGGCTCAGTGTTGG - Intronic
971687256 4:29786140-29786162 CCATATCGAGGGCTCAGTGTTGG + Intergenic
971857528 4:32061907-32061929 TTATATTGAGGGCTCAGCGTTGG + Intergenic
972085348 4:35208033-35208055 CCATATTGAAGGCTCAGTGTTGG - Intergenic
972095610 4:35343639-35343661 CCATAGTGAGGGCTCAGTGTTGG - Intergenic
972201175 4:36716235-36716257 CCATAGCAAGGGCTCAGTGTTGG + Intergenic
972240751 4:37189195-37189217 CCATATTGGGGATTCAGTGTTGG - Intergenic
972806053 4:42530276-42530298 CCATATCAAGGGCTCAGTGCTGG - Intronic
972882843 4:43447225-43447247 CCATATCAAGGGCTCAGTGTTGG + Intergenic
973092710 4:46158043-46158065 CCATATCGAGGGCTCAGTGTTGG - Intergenic
973118562 4:46489992-46490014 CCATATCAAAGGTTCAGTGTTGG - Intergenic
974232641 4:59136722-59136744 CCATATTGCAGATTCAGTGTTGG + Intergenic
974243487 4:59283087-59283109 CCCTGTTGCGGGCTCAGTTTTGG + Intergenic
974478925 4:62419944-62419966 CCATATTGACAGCTCAGTGTTGG + Intergenic
974727353 4:65813486-65813508 TCATATCAAGGACTCAGTGTTGG - Intergenic
974746803 4:66088040-66088062 CCATATTGAGGGCTCAGTGTTGG + Intergenic
975881057 4:78908480-78908502 TTATACTGAGGGCTCAGTTTTGG + Intronic
975982470 4:80176330-80176352 CCATATTGAGAGCTCAGTGTTGG + Intergenic
976034073 4:80794875-80794897 CCATATTGAGGGCTCAGTGTTGG + Intronic
976301214 4:83517184-83517206 CCATATCAGGGGCTCAGTGCTGG + Intronic
977031776 4:91892757-91892779 CCATACTGAGGGCTCAGTGTTGG - Intergenic
977430900 4:96929158-96929180 CCATATTGAGGGCTTAGTGTTGG - Intergenic
977466138 4:97384323-97384345 TCATATCAAGGGCTCAGTGTTGG - Intronic
977701613 4:100028938-100028960 CCATATCGAGAGCTTAGTGTTGG + Intergenic
977824914 4:101519680-101519702 CCATATTGAAGACTCAGCATTGG - Intronic
977833095 4:101616892-101616914 CCATATCACGGGCTCAGTGTTGG + Intronic
977898839 4:102395533-102395555 CCATATTGAGGGCTCAGTGTTGG - Intronic
977930273 4:102742872-102742894 CCATATCGTGGGCTCAGTGTCGG + Intronic
978341444 4:107724600-107724622 TCATATTGCGGGCTCAGTGTTGG + Intergenic
978432272 4:108645187-108645209 CCATATTGTGGGCTCATTGTTGG + Intergenic
978811535 4:112854836-112854858 CCAGAGAGAGAGCTCAGTGTGGG + Intronic
978898935 4:113925865-113925887 CCATATTGAGGGCTCAGTGTTGG + Intronic
979228252 4:118316409-118316431 CCATATTCAGGCCTCACTCTAGG + Intronic
979402559 4:120266214-120266236 CCTTAATGAGGGCACAGTTTAGG + Intergenic
979767138 4:124475543-124475565 CCATATTGAGGACTCAGTATTGG - Intergenic
979898283 4:126188119-126188141 TCATATCTAGGGCTCACTGTTGG + Intergenic
980405758 4:132352842-132352864 CCATATTGAGGGCTTAGTGTTGG + Intergenic
980602337 4:135040957-135040979 CCATATCGAGGGCTCAGTGTTGG - Intergenic
980629644 4:135415210-135415232 CCATATCGAGGGCTCAGATTTGG - Intergenic
980659733 4:135841743-135841765 CCATATTTGGGATTCAGTGTTGG - Intergenic
980957864 4:139446862-139446884 CCATTTCGAGGGCTCAGTGTTGG - Intergenic
981104754 4:140867584-140867606 GCAGATTTAGGGCTTAGTGTTGG + Exonic
981462944 4:145032741-145032763 CCACATCAAGGGCTCAGTGTTGG - Intronic
981562839 4:146066168-146066190 CCATATTGCAGGATCAGTATTGG - Intergenic
981873668 4:149516145-149516167 CCATATCGAGGACTCAGTGTTGG - Intergenic
982168028 4:152633120-152633142 GCATTTTGAAGGCTCACTGTGGG + Intronic
982597643 4:157406106-157406128 CCATATCAAGGACTCAGTGATGG + Intergenic
982623204 4:157731940-157731962 CCGTATCAAGGGCTCAATGTTGG + Intergenic
982835681 4:160117593-160117615 CCATATCAAGGGCTCAGTGTTGG - Intergenic
982847913 4:160275248-160275270 CCATATGGAGGGCTCAGTGTTGG - Intergenic
983027535 4:162756236-162756258 CCATATTGAGGGCTCAGTGTTGG - Intergenic
983185204 4:164692522-164692544 CCATATCGAGGGCTCAGTGTTGG - Intergenic
983582815 4:169325761-169325783 CCATATCAAGGGCTCAGTGTTGG - Intergenic
983961276 4:173757765-173757787 CCACACTGAGGGCTTAGTGTAGG - Intergenic
984060152 4:174981080-174981102 CCAAATAGAGGGCTCAGTTTTGG + Intergenic
984537165 4:180990777-180990799 CCATGTTGAAAGCTCTGTGTAGG + Intergenic
986036912 5:3949503-3949525 CCATATTGAGGGATGGGTGTTGG + Intergenic
986087233 5:4463665-4463687 CCATATCGAGGGCTCAGTGTTGG - Intergenic
986261501 5:6151576-6151598 CCATATCAAGGGCTCAGTGTTGG + Intergenic
986531269 5:8739366-8739388 TCATATCGAGGGCTCAGTGTTGG + Intergenic
986743084 5:10720706-10720728 CCGTATTGAGGGCTCAGTGTTGG - Intronic
986766291 5:10931252-10931274 CCAAATCAAGGGCTCAGTGTTGG - Intergenic
986938210 5:12917804-12917826 CCACACTGAGGGCTCAGTGTTGG + Intergenic
987090815 5:14506660-14506682 ACACACTGAGTGCTCAGTGTTGG - Intronic
987504521 5:18750785-18750807 CCATATCGAGGGATCAGTGTTGG - Intergenic
987578211 5:19757363-19757385 CCATATTGAGGGCTCAGTGTTGG + Intronic
987629844 5:20455322-20455344 TCATATTGAGGGCAAAGTGATGG - Intronic
987885578 5:23807448-23807470 CCATATCGAGGGCTCAGTGTTGG - Intergenic
988079701 5:26400482-26400504 CCATATTGAGGGCTCAGTGTTGG + Intergenic
988092555 5:26562232-26562254 CCATATTGAGGGCTCAGTGTCGG - Intergenic
988107884 5:26773489-26773511 CCATATCGAGGGCTTATTGTTGG - Intergenic
988122170 5:26979611-26979633 TCATATAAAGGGCTCAGAGTTGG - Intronic
988160692 5:27515922-27515944 CCATATGTAGGCCTCCGTGTTGG + Intergenic
988169075 5:27631890-27631912 CCATATCAAGGGCTCAGTGTTGG + Intergenic
988205170 5:28124405-28124427 CCATATTAAGGGCTCAGTGTTGG + Intergenic
988228885 5:28449073-28449095 CTATATTGAGGGCTCAGTGTTGG - Intergenic
988494291 5:31731906-31731928 CCTTTTTGAGGGCTCAGCGTTGG + Intronic
988562259 5:32291787-32291809 CCATATCGAGGGCTCAGTGTTGG - Intronic
988583496 5:32489248-32489270 CCATAATGAGGGCTGAGTGTTGG + Intergenic
988785393 5:34561966-34561988 TCATATTGAGGGCTCAGTGTTGG + Intergenic
989045020 5:37266338-37266360 CCACATAGAGGGCTCAGTGTTGG + Intergenic
989307370 5:39973675-39973697 CCATATAGAGAGTTCAGCGTTGG + Intergenic
989457515 5:41660820-41660842 CCATATCGAGGGCCCAGTGTTGG + Intergenic
989625102 5:43421838-43421860 CAATAGTGTGGGCTCAGTGAAGG + Intergenic
991013658 5:61909940-61909962 CCATATCGAGGGCTCAGTGTTGG + Intergenic
991033685 5:62106871-62106893 CCATATCGAGTGCTTAGTATTGG - Intergenic
991330609 5:65488734-65488756 CCATATCAAGGGCTCAGTGTTGG + Intergenic
991946278 5:71901072-71901094 TCATATCAGGGGCTCAGTGTTGG - Intergenic
992069055 5:73133176-73133198 CCTTTTTAATGGCTCAGTGTTGG + Intergenic
992109761 5:73481925-73481947 CCATATTGAGGATTCAGTATTGG + Intergenic
992243089 5:74790800-74790822 TCATATTAAGGGCTTAGTGTTGG - Intronic
993197679 5:84769798-84769820 CCATATTTGGGACTCAGTGTTGG + Intergenic
993203523 5:84848491-84848513 CCATATCGAGGGGTTAGTGTTGG - Intergenic
993231783 5:85246591-85246613 CCATACTGAGGGCTCAGTGTTGG + Intergenic
993367338 5:87050016-87050038 CCATATCGAGGGTTCAGTGTTGG + Intergenic
993412444 5:87590871-87590893 CCATATTGAGAGCTCAGTGTTGG + Intergenic
993780807 5:92063338-92063360 TCATATTGAGGGCTCAGTGTTGG - Intergenic
993791909 5:92219855-92219877 CCATATCGAGGGCTCAGTGTTGG - Intergenic
994917071 5:105994414-105994436 CCATATTGAGGGCTCAGTGTTGG - Intergenic
994984278 5:106914779-106914801 CCATATCGAGGGCTTGGTGTTGG + Intergenic
995269433 5:110204532-110204554 CCATATCAAAGGCTCAGTGTTGG + Intergenic
995324390 5:110873965-110873987 CCATATCAAGAGCTCATTGTTGG - Intergenic
995716563 5:115086583-115086605 CCATATTTAGGGCTCAGTATTGG - Intergenic
995776149 5:115726752-115726774 CCATATTGAGGGCTCAGTGTTGG + Intergenic
996018691 5:118568818-118568840 CCATATCAATGGCTCAGTGTTGG - Intergenic
996635136 5:125679898-125679920 CCATAAGCAGGGCTCAGTGTTGG - Intergenic
996825697 5:127678775-127678797 CCATATCGAGGGCTCAGTGTTGG - Intergenic
996912074 5:128667734-128667756 CCATCTTGGGGGCTCCATGTTGG + Intronic
996912318 5:128669795-128669817 CCATCTTGGGGGCTCCATGTTGG + Intronic
998290198 5:140907605-140907627 CCATATCAAGGGCTCAGTGTTGG + Intronic
999018559 5:148137204-148137226 ACATTTTGAGGGCTCAGACTTGG - Exonic
999351505 5:150875780-150875802 CCATATCAAGGGCTCCGTGTTGG - Intronic
999637387 5:153636814-153636836 ACATAGTGAGTGCTCAGTGTTGG + Intronic
1000417103 5:160994849-160994871 CCAGATCAAGGGCTCAGTGTTGG - Intergenic
1000422736 5:161056911-161056933 CCATATCAGGGGCTCAGTGTTGG + Intergenic
1001173740 5:169445588-169445610 TCATATCGAGGGCTCAGTGTTGG - Intergenic
1001838982 5:174857082-174857104 CCATATCGAAGGCTCTGTGTTGG - Intergenic
1002998104 6:2305708-2305730 CTATATTGAGGGCTCAGTGCTGG - Intergenic
1003695765 6:8405214-8405236 TCATATCTAGGGTTCAGTGTTGG + Intergenic
1003758746 6:9151033-9151055 CTATATCTAGGGCTCAGTGTTGG - Intergenic
1003791362 6:9550996-9551018 CTATATAAAGGGCTCAGTGTTGG - Intergenic
1004824158 6:19402285-19402307 CCATATCGAGGGCTCAATGTTGG + Intergenic
1005185308 6:23158013-23158035 TCATATTGAGGACTCAGTGTTGG - Intergenic
1005225656 6:23638996-23639018 CCATACTGGGGGCTGAGGGTTGG + Intergenic
1006001682 6:30970022-30970044 CTATACTGAGGGCTCAGTGTTGG - Intergenic
1006062478 6:31434153-31434175 TCATATTGAGAGCTCAGTGTTGG - Intergenic
1006737251 6:36283135-36283157 CAATATTGATGTCTTAGTGTTGG - Intronic
1008340393 6:50357227-50357249 CCACATTGAGGGCTCAGTGTTGG - Intergenic
1008400416 6:51056414-51056436 CCATATAGAGGGCTCAGTGTTGG - Intergenic
1008820526 6:55626090-55626112 TCATATCAAAGGCTCAGTGTTGG - Intergenic
1009389976 6:63134126-63134148 TCATATCGAGGGCTCAGTGTTGG + Intergenic
1009660563 6:66605982-66606004 TCATATCAAGGGCTCAGTGTTGG + Intergenic
1009806620 6:68607892-68607914 TCATATCGAGGGCTCAATGTTGG - Intergenic
1009851787 6:69208008-69208030 CCATATCGAGGGCTCGGCGTTGG + Intronic
1010016033 6:71105533-71105555 CCATATTGGGGGCTCAATATTGG + Intergenic
1010107816 6:72189623-72189645 CCATATTAAGGGCTCAGTGTTGG + Intronic
1010323701 6:74541439-74541461 CCATATCAAGGGCTCAGTGTTGG - Intergenic
1010818761 6:80389357-80389379 CCATATCAAGGGCTCAGTGTTGG - Intergenic
1010938114 6:81885475-81885497 CCATATCAAGGGCTCAGTGTTGG + Intergenic
1011039221 6:83012352-83012374 CCATATCAAGGGCTCAGTGTTGG + Intronic
1011069240 6:83362602-83362624 CCATATCGAGGGCTCAGTGTTGG - Intronic
1011136530 6:84106453-84106475 CCATATTGAGGACTCAGGGTTGG + Intergenic
1012118421 6:95333902-95333924 CCTTAGTGGGGGCTCTGTGTGGG + Intergenic
1012195470 6:96335867-96335889 CCACAGTGGGGACTCAGTGTGGG - Intergenic
1012344717 6:98171270-98171292 CCATATAGAAGGCTCAGTGTTGG - Intergenic
1012730578 6:102875214-102875236 CCATATTGAGGGCTCAGTGTTGG - Intergenic
1012820901 6:104083714-104083736 CCGTATTGAGGGCTCAGTGTTGG - Intergenic
1012920656 6:105218600-105218622 CCATATTGAGGGCTCAGTGTTGG + Intergenic
1013357636 6:109360531-109360553 CCATATTGCAGCCTCAGTATTGG - Intergenic
1013406804 6:109850749-109850771 CCATATTGAGGGCTCAGTGTTGG - Intergenic
1014363268 6:120507400-120507422 TCATATCGAGTGCTCAGTGTTGG + Intergenic
1014417129 6:121196354-121196376 CCATATCAAGGACTCAGTGTTGG - Intronic
1014446523 6:121534451-121534473 CCATATTGGGGATTCAGTGTTGG + Intergenic
1014455854 6:121634470-121634492 CCTTATCGAGGGCTTAGTGTTGG - Intergenic
1014534057 6:122595656-122595678 CCATATCGAGGGCTCAGTATTGG + Intronic
1014538716 6:122648814-122648836 CCATATTGGGGACTCAGTGTTGG + Intronic
1014631775 6:123797741-123797763 CCATATCGAGTGCTCAGTGTTGG - Intergenic
1015095322 6:129408668-129408690 CCAGACGGAGGGCTCAGTGTTGG + Intronic
1015346045 6:132161111-132161133 CTGTATTGGGGGCTTAGTGTTGG - Intergenic
1015475884 6:133658430-133658452 CCATATCAAAGGCTCAGTGTTGG - Intergenic
1015822859 6:137281875-137281897 CCATCTTGAGGCCTCAGCCTGGG - Intergenic
1016119803 6:140331745-140331767 CCGTACAGAGGGCTCAGTGTTGG + Intergenic
1016147194 6:140691766-140691788 CCATATCAAAGGCTCAGTGTTGG + Intergenic
1016419482 6:143869721-143869743 CCATATCGAGGTCTCAGTGTTGG + Intronic
1016466666 6:144332248-144332270 CCATATGGAGAGCACAGTCTTGG - Intronic
1016576132 6:145571640-145571662 CCATATCGAGGGCTCAGTGTTGG + Intronic
1017686075 6:156914530-156914552 CCATGACCAGGGCTCAGTGTTGG + Intronic
1018534901 6:164809557-164809579 CCATATCAAGGGCTCACTCTTGG + Intergenic
1018600018 6:165528449-165528471 CCATATCGAGGGCTTAGTGTTGG - Intronic
1018915556 6:168130482-168130504 ACATATTGGCGGCTGAGTGTGGG + Intergenic
1019349957 7:550010-550032 CCAGATTGAGGTCTGAGTGTGGG - Exonic
1020176025 7:5882790-5882812 CCATATTGAGGGCTTTGCATGGG - Intronic
1021923573 7:25512771-25512793 CCATGTTGAGGGCTGCCTGTGGG - Intergenic
1021988946 7:26123869-26123891 CCATATTGAGGGCTCAGTGTTGG - Intergenic
1022079021 7:27001278-27001300 TCATATCGAGGGCTCAGTGTTGG - Intergenic
1022476796 7:30716306-30716328 CCAGAGTGAAGGCTCAGTGCAGG + Intronic
1022898142 7:34773624-34773646 ACCTATTGAGGGCTCCTTGTTGG + Intronic
1023584960 7:41719605-41719627 GCAAATTGAAGGCTCAGGGTAGG - Intergenic
1024000253 7:45184902-45184924 CCCCATTGGGGGCACAGTGTAGG + Intronic
1024040675 7:45551094-45551116 CCATATTGAGGACTCAGTGTTGG - Intergenic
1024866226 7:53907292-53907314 CCATATTGAGGGCTCGCTGATGG - Intergenic
1026046357 7:66908164-66908186 CCATATCAAGGGCTCAGTGTTGG + Intergenic
1027406926 7:77872058-77872080 CCATATGGAGGGCTCAGTGTTGG + Intronic
1027685930 7:81278902-81278924 CCACATTAAGGGCTCAGTGTTGG - Intergenic
1028043976 7:86092409-86092431 CCATATCAAGGGCTCTGTGTTGG - Intergenic
1028141865 7:87282937-87282959 CTATATTGAGGGCTCACTGTTGG - Intergenic
1028334892 7:89639669-89639691 ACATATTGTGGGCTCAGTTTTGG + Intergenic
1028935144 7:96456012-96456034 CCGTATCGAGGGCTCAGGGTTGG - Intergenic
1029919868 7:104251797-104251819 ACATATTGGGAGCTCAGTGTTGG - Intergenic
1030192398 7:106822606-106822628 CTGTATCAAGGGCTCAGTGTGGG - Intergenic
1030277679 7:107737587-107737609 CCATATTGAGGGCTCAGTGTTGG - Intergenic
1030368891 7:108674987-108675009 CCATATTAAGGGCTCAGTGTTGG - Intergenic
1030457327 7:109792098-109792120 CCATATCGAGGGCTCAGTGTTGG + Intergenic
1030883151 7:114905600-114905622 CCATATCGAGGGCTCAGTGTTGG + Intergenic
1030931155 7:115524734-115524756 CCATATCGAGGGCTCAGTGTTGG + Intergenic
1031283945 7:119841358-119841380 CCACAGTGAGGACTCTGTGTGGG - Intergenic
1031682163 7:124688295-124688317 CCATATCAAGGTGTCAGTGTTGG - Intergenic
1032152970 7:129446012-129446034 CCTTATCCAGGGCTCAGTGTTGG + Intronic
1032923352 7:136575182-136575204 CCATATCGAGGGCTCAGAGTTGG + Intergenic
1033076395 7:138253994-138254016 CCATATTGAGGATTCAGTATTGG - Intergenic
1033315601 7:140294728-140294750 CCATATTAGGGCCTCAGTATGGG + Intronic
1033398792 7:141001312-141001334 GGACTTTGAGGGCTCAGTGTTGG + Intergenic
1033808026 7:144976689-144976711 CCATCTAGAGGGCTCAAAGTTGG - Intergenic
1035395587 7:158532874-158532896 CCATCTTGATGGCTCAGGGACGG + Intronic
1037675592 8:21048230-21048252 CCATATCAAGGACTCATTGTTGG + Intergenic
1038611718 8:29065207-29065229 CCATATTGAGGGTGCAGTCTGGG - Intergenic
1038722928 8:30054221-30054243 CCGTATTCAGGGTTCAGTGTTGG + Intergenic
1039324043 8:36465598-36465620 CCATATTGAGGGCTCAGTGTTGG + Intergenic
1040912073 8:52529362-52529384 CCATATCAAGGGCTCGGTGTTGG - Intergenic
1041802913 8:61819467-61819489 CCATATAAAGCACTCAGTGTTGG + Intergenic
1041986316 8:63925417-63925439 CCATATCGAGGGCTCAGTGTTGG - Intergenic
1042000929 8:64123047-64123069 CCATATTGAGGGCTCAGTGTTGG + Intergenic
1042342548 8:67695334-67695356 CCATATTGGGGACTCAGTGTTGG - Intronic
1042998707 8:74731249-74731271 CCATATCTTGGGCTCAGTGTTGG - Intronic
1043258056 8:78159766-78159788 CCATATTGAGAGCTCAATGTTGG - Intergenic
1043317618 8:78940956-78940978 CTATTATGAGGACTCAGTGTTGG + Intergenic
1044028939 8:87210848-87210870 CCTTAGTGAGGACTCTGTGTAGG - Intronic
1044150927 8:88774017-88774039 CCATATCAAGGGCTCAGTGTTGG - Intergenic
1044202521 8:89453435-89453457 CCATATCTAGGGCTCAGTGTTGG - Intergenic
1044285843 8:90411498-90411520 CCATATCGAGGGCTCAGTGTTGG + Intergenic
1044487026 8:92766236-92766258 CCATATAAAGGTCTCAGTGTTGG + Intergenic
1044535377 8:93351672-93351694 CCATATCAGGGACTCAGTGTTGG - Intergenic
1044633016 8:94297455-94297477 CCATATTGAGGGCTCAGTGTGGG + Intergenic
1044895934 8:96891371-96891393 CCATATCGAGGGCTCAGTGTTGG + Intronic
1045410246 8:101910079-101910101 CCTCACTGAGGTCTCAGTGTAGG - Intronic
1045530271 8:102978126-102978148 TCACATCAAGGGCTCAGTGTTGG + Intergenic
1045565241 8:103308004-103308026 CCATATTGAGGGCTTAAGGTTGG + Intronic
1046081861 8:109379141-109379163 GCCTATTGAGAGCTCAGTGTTGG - Intronic
1046128540 8:109940649-109940671 CCACATCGAGGGCTCAGTGTTGG + Intergenic
1046433106 8:114153710-114153732 CCACAGTGAGGACTCTGTGTGGG + Intergenic
1046585655 8:116146791-116146813 CCATATTGAGGGCTCAGTGTTGG + Intergenic
1046863171 8:119117486-119117508 CCCTAGTGAGGACTCTGTGTTGG + Intergenic
1047652663 8:126940279-126940301 CCATATTGAGTGATCAGAGCAGG - Intergenic
1048393887 8:133994522-133994544 GCCTATTGAGGGCTCAGCCTTGG + Intergenic
1048909967 8:139125827-139125849 CCATACTGGGGGCTCAGTGTTGG + Intergenic
1049453856 8:142677147-142677169 CCACAGTGAGGGCTCAGTTTTGG + Intronic
1050044438 9:1528223-1528245 CCGTATTGGGAGCTCAGTGATGG + Intergenic
1050482810 9:6103544-6103566 CCATATCGAGGGCTCGGTGTTGG - Intergenic
1050901913 9:10960557-10960579 CTATATTAAGGGCTCAATGTTGG - Intergenic
1051122081 9:13762238-13762260 CCACATTAGAGGCTCAGTGTGGG + Intergenic
1051475929 9:17509224-17509246 CCATATCAAGGGCTGAGTGTTGG - Intergenic
1051809891 9:21036873-21036895 CCAAATTCAGGGCACAATGTGGG - Intergenic
1051979950 9:23001487-23001509 GCATATAGAGAGCTCACTGTTGG - Intergenic
1052187757 9:25619939-25619961 CCCCATTGAGGACTCTGTGTGGG + Intergenic
1052227712 9:26109320-26109342 CCATATTGAGGGCTCAGTGTTGG - Intronic
1052368782 9:27641784-27641806 CCATATCGAGGGCTCAGTGTTGG - Intergenic
1052442134 9:28511348-28511370 CCATATTGAGGGCTCAGTGTTGG + Intronic
1052561443 9:30089052-30089074 CCCTATCGAGGGCTCAGTGTTGG + Intergenic
1055903808 9:81270247-81270269 CCATATTGAGGGCTCAGTGTTGG + Intergenic
1056156807 9:83846141-83846163 CCATATTGAGGGCTCAGTGTTGG - Intronic
1056314100 9:85371998-85372020 CCATATCAAAGTCTCAGTGTTGG + Intergenic
1056353729 9:85777385-85777407 CCATATTGAGGGCTCAGTGTTGG + Intergenic
1058020039 9:100077008-100077030 CCTTATTGAGGGCTCAGTGTTGG - Intronic
1058124708 9:101178325-101178347 CCATATCTAGGGCTCAGTGTTGG - Intronic
1058259133 9:102808741-102808763 CCATATTGAGGGCTCAGTGGTGG + Intergenic
1058544048 9:106041809-106041831 CCATATCAAAGTCTCAGTGTTGG + Intergenic
1059196370 9:112374920-112374942 CCATATTGAGGGCTCAGTGTTGG + Intergenic
1059485873 9:114626421-114626443 CTATATTGAGTGCTCACTGAGGG + Intronic
1060833805 9:126739629-126739651 CCATCTTGGGGGCTCAGTGTTGG + Intergenic
1186279640 X:7978064-7978086 CCACATCGAGGGCTCAGTGATGG - Intergenic
1186469633 X:9811189-9811211 CCATATCAAGGGCTCAGTGTTGG + Intronic
1187524050 X:20038073-20038095 GCATATCGAGGGCTCAGAGTTGG - Intronic
1189412505 X:40785374-40785396 CCATTTTGAGGGCTCAGCTTTGG - Intergenic
1189964082 X:46353858-46353880 CTATATTGGGGGCTCAGTGTTGG + Intergenic
1190876199 X:54461975-54461997 CCACTCTCAGGGCTCAGTGTGGG + Intronic
1190996622 X:55616541-55616563 CCATATTGAGGGTTCAGTGTTGG + Intergenic
1191009195 X:55743389-55743411 CCATATCAGGGACTCAGTGTTGG + Intronic
1191095586 X:56670243-56670265 CCATGTCGAGTGCTCAATGTTGG + Intergenic
1191133917 X:57043573-57043595 CCATATTGAGGGCTCAGTGTTGG + Intergenic
1191588226 X:62851956-62851978 CCATATTGGGGACTCAGTGTTGG - Intergenic
1191629895 X:63311638-63311660 CCATATAGAAGTTTCAGTGTTGG + Intergenic
1191658667 X:63628862-63628884 CCATATTGAGGGCTCGGTGTTGG + Intergenic
1191719112 X:64214766-64214788 TCATATGGAGGGCTCAGTGTTGG + Intergenic
1191759482 X:64630842-64630864 CCATATCGAGGGCTTGGAGTTGG - Intergenic
1191769371 X:64739152-64739174 CCATATCGAGGGCTCAGTGTTGG + Intergenic
1191933038 X:66395090-66395112 TCATATCGAGGGCTCAGTGTTGG - Intergenic
1191941132 X:66482932-66482954 CCATATCGAGGGCTCAGTGTTGG + Intergenic
1191946479 X:66539966-66539988 CCATATAGAGGGCTCAGTGTTGG - Intergenic
1192297584 X:69867082-69867104 CTATATCGAGGGCTCAGTGTTGG + Intronic
1192625936 X:72728794-72728816 CGACATTGAGGACTGAGTGTTGG - Intergenic
1192661444 X:73046839-73046861 CCATGTCAAGGGCTCAGTGTTGG + Intergenic
1192996307 X:76516522-76516544 CCATATCGAGGGCTCAGTGTTGG - Intergenic
1193053621 X:77126713-77126735 CCATATCAAAGGCTCAGTATTGG - Intergenic
1193288049 X:79737173-79737195 CCATATGGAGGGCTCAGTGTTGG - Intergenic
1193297903 X:79853602-79853624 CAACATTGAGGTCTCAGTGTTGG - Intergenic
1193447289 X:81619708-81619730 CCATATCAAGGGCTCAGAGTTGG - Intergenic
1193957422 X:87879163-87879185 TCATATCGAGAGCTCAGTGTAGG - Intergenic
1194140702 X:90205228-90205250 CTACACTGGGGGCTCAGTGTTGG + Intergenic
1194174752 X:90631774-90631796 CCATATCCAGGGCTCAGTGTTGG - Intergenic
1194179479 X:90694992-90695014 CCATATTGAGGGCTCAGTGTTGG + Intergenic
1194210402 X:91063296-91063318 CCATATTGAGGGCTCAGTGTTGG - Intergenic
1194232983 X:91347230-91347252 CTATATTGAGGGCTCAGTGTTGG - Intergenic
1194343441 X:92732030-92732052 CCATATCGAGGGATCAGTGTTGG - Intergenic
1194453984 X:94079895-94079917 CCATATCGAGGGCTCAGTGTTGG + Intergenic
1194455317 X:94095786-94095808 CCATATGGGAAGCTCAGTGTTGG + Intergenic
1194475024 X:94347871-94347893 CTATATCAAGGGCTCAGTCTTGG - Intergenic
1194485233 X:94478257-94478279 CCATATCGAGGGCTCAGTGCTGG - Intergenic
1194513298 X:94821317-94821339 CCATATTGAGAGCTCAGTGCTGG + Intergenic
1194521193 X:94920384-94920406 CAATATCGAGGGCTCAGTGTTGG - Intergenic
1194584243 X:95714005-95714027 CCATATCAAGGGCTCAGTGTTGG - Intergenic
1194604249 X:95960907-95960929 CCATATTGAGGGCTCAGTGTTGG + Intergenic
1194649539 X:96498781-96498803 CCATATTGGGAGCTCAGTGTTGG - Intergenic
1194834080 X:98659741-98659763 CCATATTGAAGGCTCAGTGTTGG - Intergenic
1195748388 X:108141125-108141147 CCATATTGAGGGCTCAGTGTTGG + Intronic
1195748797 X:108144416-108144438 CTATATTGAGGGCTCAGTGTTGG + Intronic
1195782220 X:108478929-108478951 CCATATCGAGTGCTCATTTTTGG + Intronic
1195809663 X:108815903-108815925 CCATACTGAGGGCTCAGTGTTGG + Intergenic
1197044546 X:121979254-121979276 CCATATCAAGGGCTCAGTGTTGG - Intergenic
1197084076 X:122452557-122452579 CCATATCAAAGGCTCAGTGTTGG + Intergenic
1197097538 X:122613358-122613380 ACATATCCAGGTCTCAGTGTTGG - Intergenic
1197182228 X:123548727-123548749 CCATATCGAGGGCTCAGTGTTGG - Intergenic
1197244917 X:124158056-124158078 CCATATCGAGGGCTCAGTGTTGG + Intronic
1197386649 X:125811303-125811325 CCATATTGCGGTCTCAGCATTGG + Intergenic
1197420009 X:126227277-126227299 CCATATCAAGAGCTCAGTGTTGG - Intergenic
1197522080 X:127511239-127511261 CCATATTGGGGGCTGGATGTTGG - Intergenic
1197537399 X:127707427-127707449 CCATATCGAGGGCTCAGCGTTGG - Intergenic
1197592005 X:128420331-128420353 CCACATCCAGGGCTCAGTGTTGG - Intergenic
1198170135 X:134097185-134097207 CCACATTGTGGGCCCAGTGTTGG - Intergenic
1198340664 X:135710532-135710554 CTAAATTGGGGGCTTAGTGTTGG + Intergenic
1198347302 X:135771196-135771218 CCAAATTGGGGGCTTAGTGTTGG - Intergenic
1198347564 X:135773778-135773800 CCATATTGGGGACTCAGTGTTGG - Intergenic
1198349208 X:135788457-135788479 CCAAATTGGGGGCTTAGTGTTGG - Intergenic
1198349469 X:135791039-135791061 CCATATTGGGGACTCAGTGTTGG - Intergenic
1198351113 X:135805730-135805752 CCAAATTGGGGGCTTAGTGTTGG - Intergenic
1198351374 X:135808312-135808334 CCATATTGGGGACTCAGTGTTGG - Intergenic
1198353020 X:135822995-135823017 CCAAATTGGGGGCTTAGTGTTGG - Intergenic
1198353283 X:135825578-135825600 CCATATTGGGGACTCAGTGTTGG - Intergenic
1198354929 X:135840250-135840272 CCAAATTGGGGGCTTAGTGTTGG - Intergenic
1198355190 X:135842832-135842854 CCATATTGGGGACTCAGTGTTGG - Intergenic
1198356839 X:135857533-135857555 CCAAATTGGGGGCTTAGTGTTGG - Intergenic
1198357100 X:135860115-135860137 CCATATTGGGGACTCAGTGTTGG - Intergenic
1198358752 X:135874812-135874834 CCAAATTGGGGGCTTAGTGTTGG - Intergenic
1198359014 X:135877394-135877416 CCATATTGGGGACTCAGTGTTGG - Intergenic
1198701434 X:139401243-139401265 CCGTATCGAGGGCTCAGTGTTGG - Intergenic
1198756335 X:139986466-139986488 CCATACTGGGGGCTCAGTCTTGG - Intergenic
1198782907 X:140256865-140256887 CCATATCAAGAGCTCAGTATTGG + Intergenic
1198934168 X:141888802-141888824 CCATATCGAGGGCTCAGTGTTGG - Intronic
1198941699 X:141963846-141963868 CCCTAGTGAGGGCTCTGTGTGGG + Intergenic
1199116446 X:143998316-143998338 CCATATCGAGGAGTCAGTATTGG + Intergenic
1199144331 X:144348031-144348053 CCATATCAAGGGCTCAGTGTTGG + Intergenic
1199997816 X:153037544-153037566 CCATATTGGGGTCTCAGCATTGG - Intergenic
1200129249 X:153831954-153831976 TCATATTGAGGGCTCAGCATCGG + Intergenic
1200340348 X:155389696-155389718 CCATATTGAGGGCTCAGCGCTGG + Intergenic
1200486468 Y:3774355-3774377 CTACACTGGGGGCTCAGTGTTGG + Intergenic
1200521398 Y:4212963-4212985 CCATATCCAGGGCTCAGTGTTGG - Intergenic
1200651795 Y:5848695-5848717 CCATATCGAGGGATCAGTGTTGG - Intergenic
1200745925 Y:6903925-6903947 CCATATTAAGGGCTCAGTGATGG + Intergenic
1200973010 Y:9176770-9176792 CCATAACAAGGGCTCAGTGTTGG + Intergenic
1201796543 Y:17902691-17902713 CCATACTGAGGGCTCAGTTTTGG + Intergenic
1201798532 Y:17927613-17927635 CCCTATCGACGGATCAGTGTTGG - Intergenic
1201803021 Y:17978344-17978366 CCCTATCGACGGATCAGTGTTGG + Intergenic
1201805012 Y:18003294-18003316 CCATACTGAGGGCTCAGTTTTGG - Intergenic
1202134441 Y:21647162-21647184 CCATATTGAGAGCTCAGTGTTGG + Intergenic
1202138068 Y:21687739-21687761 CCATAACATGGGCTCAGTGTTGG - Intergenic
1202242962 Y:22789377-22789399 GCATATCCAGGGCTCAGTGAGGG - Intergenic
1202357928 Y:24071753-24071775 CCATACTGAGGGCTCAGTTTTGG + Intergenic
1202359851 Y:24096303-24096325 CCATATCGACGGATCAGTGTTGG - Intergenic
1202395949 Y:24423127-24423149 GCATATCCAGGGCTCAGTGAGGG - Intergenic
1202474836 Y:25246965-25246987 GCATATCCAGGGCTCAGTGAGGG + Intergenic
1202510927 Y:25573811-25573833 CCATATGGACGGATCAGTGTTGG + Intergenic
1202512850 Y:25598360-25598382 CCATACTGAGGGCTCAGTTTTGG - Intergenic