ID: 1194604389

View in Genome Browser
Species Human (GRCh38)
Location X:95961962-95961984
Sequence GACAGCTTTTGGCCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194604389_1194604392 26 Left 1194604389 X:95961962-95961984 CCAGTAACAGGCCAAAAGCTGTC No data
Right 1194604392 X:95962011-95962033 GCAGTTATCAGATGATGCCAGGG No data
1194604389_1194604391 25 Left 1194604389 X:95961962-95961984 CCAGTAACAGGCCAAAAGCTGTC No data
Right 1194604391 X:95962010-95962032 AGCAGTTATCAGATGATGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194604389 Original CRISPR GACAGCTTTTGGCCTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr