ID: 1194606518

View in Genome Browser
Species Human (GRCh38)
Location X:95985570-95985592
Sequence GCCTCTCTGGACACTGAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194606518_1194606523 6 Left 1194606518 X:95985570-95985592 CCTCACTCAGTGTCCAGAGAGGC No data
Right 1194606523 X:95985599-95985621 CACCATGAGGCTGCTGCCAGGGG No data
1194606518_1194606528 16 Left 1194606518 X:95985570-95985592 CCTCACTCAGTGTCCAGAGAGGC No data
Right 1194606528 X:95985609-95985631 CTGCTGCCAGGGGTGTGGGAGGG No data
1194606518_1194606529 17 Left 1194606518 X:95985570-95985592 CCTCACTCAGTGTCCAGAGAGGC No data
Right 1194606529 X:95985610-95985632 TGCTGCCAGGGGTGTGGGAGGGG No data
1194606518_1194606525 11 Left 1194606518 X:95985570-95985592 CCTCACTCAGTGTCCAGAGAGGC No data
Right 1194606525 X:95985604-95985626 TGAGGCTGCTGCCAGGGGTGTGG No data
1194606518_1194606521 4 Left 1194606518 X:95985570-95985592 CCTCACTCAGTGTCCAGAGAGGC No data
Right 1194606521 X:95985597-95985619 TGCACCATGAGGCTGCTGCCAGG No data
1194606518_1194606527 15 Left 1194606518 X:95985570-95985592 CCTCACTCAGTGTCCAGAGAGGC No data
Right 1194606527 X:95985608-95985630 GCTGCTGCCAGGGGTGTGGGAGG No data
1194606518_1194606522 5 Left 1194606518 X:95985570-95985592 CCTCACTCAGTGTCCAGAGAGGC No data
Right 1194606522 X:95985598-95985620 GCACCATGAGGCTGCTGCCAGGG No data
1194606518_1194606526 12 Left 1194606518 X:95985570-95985592 CCTCACTCAGTGTCCAGAGAGGC No data
Right 1194606526 X:95985605-95985627 GAGGCTGCTGCCAGGGGTGTGGG No data
1194606518_1194606520 -7 Left 1194606518 X:95985570-95985592 CCTCACTCAGTGTCCAGAGAGGC No data
Right 1194606520 X:95985586-95985608 GAGAGGCTCTCTGCACCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194606518 Original CRISPR GCCTCTCTGGACACTGAGTG AGG (reversed) Intergenic
No off target data available for this crispr